zgc:153239

Ensembl ID:
ENSDARG00000063414
ZFIN ID:
ZDB-GENE-060929-1018
Description:
Transmembrane protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q08CD5]
Human Orthologue:
TMEM5
Human Description:
transmembrane protein 5 [Source:HGNC Symbol;Acc:13530]
Mouse Orthologue:
Tmem5
Mouse Description:
transmembrane protein 5 Gene [Source:MGI Symbol;Acc:MGI:2384919]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23249 Nonsense Available for shipment Available now
sa32191 Essential Splice Site Available for shipment Available now
sa23248 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092648 Nonsense 16 434 1 6
Genomic Location (Zv9):
Chromosome 18 (position 12599550)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13153129
GRCz11 18 13121847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGAGATTTTTTCGCCGGAAAATAGCGATTATAGTTATTTTGGCGTA[C/A]GCGATATTTTCGCTTTACGCAGCATATAATGTGTTTTTCAGCAAGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092648 Essential Splice Site 49 434 1 6
ENSDART00000092648 Essential Splice Site 49 434 1 6
Genomic Location (Zv9):
Chromosome 18 (position 12599451)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13153030
GRCz11 18 13121748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATTTCTCGCGTTCACCGAGTGGTGAAAAAGGGCTCTGTGATCATCGG[T/C]AAGAGAATGAATCATGTCCAGTGTAGTCTATGGGTTTGATAGTAAGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092648 Essential Splice Site 49 434 1 6
ENSDART00000092648 Essential Splice Site 49 434 1 6
Genomic Location (Zv9):
Chromosome 18 (position 12599451)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13153030
GRCz11 18 13121748
KASP Assay ID:
2261-1939.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATTTCTCGCGTTCACCGAGTGGTGAAAAAGGGCTCTGTGATCATCGG[T/C]AAGAGAATGAATCATGTCCAGTGTAGTCTATGGGTTTGATAGTAAGACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link