zgc:152925

Ensembl ID:
ENSDARG00000063385
ZFIN ID:
ZDB-GENE-060929-860
Description:
hypothetical protein LOC767754 [Source:RefSeq peptide;Acc:NP_001070189]
Human Orthologue:
CENPE
Human Description:
centromere protein E, 312kDa [Source:HGNC Symbol;Acc:1856]
Mouse Orthologue:
Cenpe
Mouse Description:
centromere protein E Gene [Source:MGI Symbol;Acc:MGI:1098230]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24832 Nonsense Mutation detected in F1 DNA During 2018
sa32570 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19390 Nonsense Available for shipment Available now
sa32571 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092584   21 317 3 10
ENSDART00000111806 Nonsense 66 2690 3 58
ENSDART00000133431   None 171 None 5
ENSDART00000148172   None 170 None 4
ENSDART00000148261   None 199 None 4

The following transcripts of ENSDARG00000063385 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 137422)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 267552
GRCz11 1 262731
KASP Assay ID:
554-7286.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTCGTGTGTTTCAGACCGTGTGTTCAGTGCGGCAGAGTCCACTGCT[C/T]AACTCTATCAGGACATCGCGAAGCCTCTGGTCGTGTCTGCAGTTGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092584 Essential Splice Site 35 317 3 10
ENSDART00000111806   80 2690 3 58
ENSDART00000133431   None 171 None 5
ENSDART00000148172   None 170 None 4
ENSDART00000148261   None 199 None 4
ENSDART00000092584 Essential Splice Site 35 317 None 10
ENSDART00000111806   80 2690 3 58
ENSDART00000133431   None 171 None 5
ENSDART00000148172   None 170 None 4
ENSDART00000148261   None 199 None 4

The following transcripts of ENSDARG00000063385 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 137466)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 267596
GRCz11 1 262775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCTCAACTCTATCAGGACATCGCGAAGCCTCTGGTCGTGTCTGCAGT[T/A]GAAGGTTATAACGGTGAGTCCAGAAATGAAGATTTATTTTTTCCAGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092584   None 317 None 10
ENSDART00000111806 Nonsense 389 2690 13 58
ENSDART00000133431   None 171 None 5
ENSDART00000148172   None 170 None 4
ENSDART00000148261   None 199 None 4

The following transcripts of ENSDARG00000063385 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 142648)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 272778
GRCz11 1 267957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGACTCAAACCACAGCGACCGAGCGAGAGTCTCTCTGTCAGCTCCTG[C/T]AGGAGAAAGACCAGCTCCAGAGAGAGCAGGAGGACCGCATCAAGAACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092584   None 317 None 10
ENSDART00000111806 Nonsense 561 2690 16 58
ENSDART00000133431   None 171 None 5
ENSDART00000148172 Nonsense 125 170 4 4
ENSDART00000148261   None 199 None 4

The following transcripts of ENSDARG00000063385 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 144437)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 274567
GRCz11 1 269746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAAGCTCTCGCATCTGCAGAACATGCTGGAGGCTCAGTCTGCACCAT[C/A]ACACGAGGAGAAAAACACCATCTCTGAGCTGGAGAAGCAGATGGAGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link