ZNF462

Ensembl ID:
ENSDARG00000063381
Description:
zinc finger protein 462 [Source:HGNC Symbol;Acc:21684]
Human Orthologue:
ZNF462
Human Description:
zinc finger protein 462 [Source:HGNC Symbol;Acc:21684]
Mouse Orthologue:
Zfp462
Mouse Description:
zinc finger protein 462 Gene [Source:MGI Symbol;Acc:MGI:107690]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9742 Nonsense Available for shipment Available now
sa18187 Nonsense Available for shipment Available now
sa7486 Missense Mutation detected in F1 DNA During 2018
hu7881 Nonsense Available for shipment Available now
sa10748 Nonsense Available for shipment Available now
sa39312 Nonsense Mutation detected in F1 DNA During 2018
sa17083 Nonsense Available for shipment Available now
sa43557 Nonsense Mutation detected in F1 DNA During 2018
sa37193 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092579 Nonsense 17 2502 1 13
Genomic Location (Zv9):
Chromosome 21 (position 537801)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 396014
GRCz11 21 345565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATGGAAGGGCTGCAGTGCGATGGCTGTGATTTTCGTGCAGAGTCGTAT[G/T]AGGAGCTGAAGGCTCACATCCGGGACATCCACACTGCCTTCCTGCAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092579 Nonsense 987 2502 2 13
Genomic Location (Zv9):
Chromosome 21 (position 541066)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 399279
GRCz11 21 348830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAYTATCAAAAGAAGCAYCCCGAGCAAAAGGCCTCATACTTCCGCATA[C/T]AGAAGACCATGCGGGTCATTWCTGTCGAGCGAGCACAGATGGCCAGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092579 Missense 1114 2502 2 13
Genomic Location (Zv9):
Chromosome 21 (position 541448)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 399661
GRCz11 21 349212
KASP Assay ID:
554-4187.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTAATTCCAAMACTAAAGGAGCATCCGACAAGGGGGAACCAGAAATGC[T/G]GTTTTTCTGTCAGCACTGCGACTAMGGGAACCGCACTGTGAAGGGGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092579 Nonsense 1293 2502 2 13
Genomic Location (Zv9):
Chromosome 21 (position 541986)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 400199
GRCz11 21 349750
KASP Assay ID:
554-2385.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTAATGTCCCAAATGGAGCATGCCTCAAAGGCGCAATCTCTACACTG[A/T]TAATGCTTTGYTTCAGAATTCCCAGCTTGCCTGCTTGTGGAAGAATYAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092579 Nonsense 1534 2502 2 13
Genomic Location (Zv9):
Chromosome 21 (position 542707)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 400920
GRCz11 21 350471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAATACCATAATCAGCCTGCTGCASACATGTTTAAAGCAAGTAAYATA[C/T]AGTCGCCRACTGGAAGGGATGATTTAGTGGCCGAATGCAGCACTAGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092579 Nonsense 1804 2502 2 13
Genomic Location (Zv9):
Chromosome 21 (position 543517)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 401730
GRCz11 21 351281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGAAGCGGGATTTCGTCACCGTCCCGAGCCCTGTAGAAGATGGCACT[G/T]AGCTCTACCAATGCACACACTGTGAAATCAAGTTCCTGACTCTTCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092579 Nonsense 1833 2502 2 13
Genomic Location (Zv9):
Chromosome 21 (position 543604)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 401817
GRCz11 21 351368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTCTTCCAGAACTCWGCATCCATCTCACGAACCACAACGAGGACTTT[C/T]AGAAAAAAGCCATGCGGATGGAAAGGAGAAAACAGCTTCAGAGCAAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092579 Nonsense 2092 2502 6 13
Genomic Location (Zv9):
Chromosome 21 (position 552691)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 410904
GRCz11 21 360455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGACGCTGACGCTGCACCGACTCAAAACTGCAGCTCCGAGAAACACA[C/T]AACCTGCAGACGAGGACGAGGAGGAGGAGGAGGAAGAGGAGGAGAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092579 Nonsense 2231 2502 8 13
Genomic Location (Zv9):
Chromosome 21 (position 555342)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 413555
GRCz11 21 363106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGCCGCTGAGGAGCCGCAGAAAGAGTTACGATGTCCGTTCTGTCTGTA[T/G]CACACCAAACACAAGAGCAGCATGATCGACCACATCGTCCTGCACAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Menarche (age at onset): Meta-analysis of genome-wide association data identifies two loci influencing age at menarche. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link