zgc:162148

Ensembl ID:
ENSDARG00000063358
ZFIN ID:
ZDB-GENE-070410-22
Description:
Calcium uptake protein 1, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:A4IG32]
Human Orthologue:
CBARA1
Human Description:
calcium binding atopy-related autoantigen 1 [Source:HGNC Symbol;Acc:1530]
Mouse Orthologue:
Cbara1
Mouse Description:
calcium binding atopy-related autoantigen 1 Gene [Source:MGI Symbol;Acc:MGI:2384909]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42129 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31903 Nonsense Available for shipment Available now
sa42130 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092521 Essential Splice Site None 488 None 12
ENSDART00000124667   None 489 None 12
ENSDART00000132301 Essential Splice Site None 489 None 13
ENSDART00000145940   None 202 None 6
Genomic Location (Zv9):
Chromosome 13 (position 4548787)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4743565
GRCz11 13 4872151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACATCTTTCCTGCAGGACTTTATCTGACGTTGCCTTAAGTGTCTGAG[T/A]AAGTGTATAATACCCGCTCGCTTTAACACCAAGGGGCTAAGTTAGACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092521 Nonsense 153 488 4 12
ENSDART00000124667 Nonsense 153 489 3 12
ENSDART00000132301 Nonsense 153 489 4 13
ENSDART00000145940 Nonsense 48 202 2 6
Genomic Location (Zv9):
Chromosome 13 (position 4576265)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4771043
GRCz11 13 4899629
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTGCCACCCTGAAGATCATCAATGAACACGGAGACGCAGAAGTGTA[C/A]ATGACACCGCAGGACTTTGTGCGCTCCATCACACCAAACGAGAAACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092521 Essential Splice Site 322 488 8 12
ENSDART00000124667 Essential Splice Site 323 489 8 12
ENSDART00000132301 Essential Splice Site 323 489 9 13
ENSDART00000145940   None 202 None 6
Genomic Location (Zv9):
Chromosome 13 (position 4628469)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4823247
GRCz11 13 4951833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTGGAGTTCCAGAGGAAATTACAGCATGATGTGCTTAAACTGGAGG[T/A]AAGGCGTATACGTCGAGGAAGATGGAGAAATGTAGACTTTTTATATGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link