si:dkey-30c15.3

Ensembl ID:
ENSDARG00000063293
ZFIN ID:
ZDB-GENE-060503-638
Description:
Novel protein similar to vertebrate neuropilin (NRP) and tolloid (TLL)-like 2 (NETO2) [Source:UniPro
Human Orthologue:
NETO2
Human Description:
neuropilin (NRP) and tolloid (TLL)-like 2 [Source:HGNC Symbol;Acc:14644]
Mouse Orthologue:
Neto2
Mouse Description:
neuropilin (NRP) and tolloid (TLL)-like 2 Gene [Source:MGI Symbol;Acc:MGI:1921763]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10605 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092351 Nonsense 220 536 7 10
ENSDART00000136608 Nonsense 218 534 6 9
Genomic Location (Zv9):
Chromosome 18 (position 6969564)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7547254
GRCz11 18 7506189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTCTGTTTGTGTCTCTCATTCAGATCTATCTCCGCTTTCTAGACTA[T/A]CAGTTGGAGAACTCAAACGAGTGTAAGAAAAACTTTGTTGCCRTTTATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link