
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fam134a
- Ensembl ID:
- ENSDARG00000063270
- ZFIN ID:
- ZDB-GENE-061215-128
- Description:
- hypothetical protein LOC564232 [Source:RefSeq peptide;Acc:NP_001073483]
- Human Orthologue:
- FAM134A
- Human Description:
- family with sequence similarity 134, member A [Source:HGNC Symbol;Acc:28450]
- Mouse Orthologue:
- Fam134a
- Mouse Description:
- family with sequence similarity 134, member A Gene [Source:MGI Symbol;Acc:MGI:2388278]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15479 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15479
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092277 | Nonsense | 96 | 545 | 2 | 9 |
ENSDART00000146473 | None | 270 | None | 2 |
The following transcripts of ENSDARG00000063270 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 5056622)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 5495184 GRCz11 1 6192962 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCCACATCCCTGAGGCCTCTGTTTCTCCTGAGTGTTTTTCTCATTGGTT[T/A]GACTCTRCTGGAGAGATGGAAAGACAAGCTGCCACAGATCACCGGTAATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: