zgc:158644

Ensembl ID:
ENSDARG00000063254
ZFIN ID:
ZDB-GENE-070112-1352
Description:
hypothetical protein LOC791165 [Source:RefSeq peptide;Acc:NP_001074116]
Human Orthologue:
C19orf22
Human Description:
chromosome 19 open reading frame 22 [Source:HGNC Symbol;Acc:28270]
Mouse Orthologue:
C030046I01Rik
Mouse Description:
RIKEN cDNA C030046I01 gene Gene [Source:MGI Symbol;Acc:MGI:1924814]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21841 Nonsense Available for shipment Available now
sa27723 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092270 Nonsense 225 274 7 8
Genomic Location (Zv9):
Chromosome 11 (position 5763115)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5731389
GRCz11 11 5672429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAATGCTATATTTTTATTCAGATGTGTCTGTGTTTCTTTAGTTATGAG[C/T]GACTGTTGCTTCATGCTATTTGCCAGTACATGGATCTGACCTCTGCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092270 Essential Splice Site 240 274 7 8
Genomic Location (Zv9):
Chromosome 11 (position 5763164)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5731438
GRCz11 11 5672478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGACTGTTGCTTCATGCTATTTGCCAGTACATGGATCTGACCTCTGCAA[G/A]TGAGTAATCTTCAGATGTTGATAATTTCAGGTTTTTTTTTTTCAATGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link