
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:158281
- Ensembl ID:
- ENSDARG00000063247
- ZFIN ID:
- ZDB-GENE-030131-2752
- Description:
- pleckstrin homology domain-containing family M member 1 [Source:RefSeq peptide;Acc:NP_001082872]
- Human Orthologues:
- AC103810.1, PLEKHM1, PLEKHM1P
- Human Descriptions:
- pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene [Source:HGNC S
- pleckstrin homology domain containing, family M (with RUN domain) member 1 [Source:HGNC Symbol;Acc:2
- Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C4AM83]
- Mouse Orthologue:
- Plekhm1
- Mouse Description:
- pleckstrin homology domain containing, family M (with RUN domain) member 1 Gene [Source:MGI Symbol;A
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6231 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6231
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092241 | Essential Splice Site | 315 | 845 | 5 | 12 |
ENSDART00000129644 | Essential Splice Site | 528 | 1058 | 5 | 11 |
ENSDART00000139801 | None | 194 | None | 4 | |
ENSDART00000145149 | Essential Splice Site | 315 | 845 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 12 (position 5911022)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 4912016 GRCz11 12 4946973 - KASP Assay ID:
- 554-4878.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAGACGAGCTTCAGCCTCCTCCCAGTGTTGTGCACCGGAGACACAACGG[T/A]AAGATGGAAAAAAGATGTTAAACGTCATGTTGTCTGCCTAATTCTGTTGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Parkinson's disease: Genome-wide association study confirms SNPs in SNCA and the MAPT region as common risk factors for Parkinson disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: