zgc:158281

Ensembl ID:
ENSDARG00000063247
ZFIN ID:
ZDB-GENE-030131-2752
Description:
pleckstrin homology domain-containing family M member 1 [Source:RefSeq peptide;Acc:NP_001082872]
Human Orthologues:
AC103810.1, PLEKHM1, PLEKHM1P
Human Descriptions:
pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene [Source:HGNC S
pleckstrin homology domain containing, family M (with RUN domain) member 1 [Source:HGNC Symbol;Acc:2
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C4AM83]
Mouse Orthologue:
Plekhm1
Mouse Description:
pleckstrin homology domain containing, family M (with RUN domain) member 1 Gene [Source:MGI Symbol;A

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6231 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092241 Essential Splice Site 315 845 5 12
ENSDART00000129644 Essential Splice Site 528 1058 5 11
ENSDART00000139801   None 194 None 4
ENSDART00000145149 Essential Splice Site 315 845 5 11
Genomic Location (Zv9):
Chromosome 12 (position 5911022)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4912016
GRCz11 12 4946973
KASP Assay ID:
554-4878.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGACGAGCTTCAGCCTCCTCCCAGTGTTGTGCACCGGAGACACAACGG[T/A]AAGATGGAAAAAAGATGTTAAACGTCATGTTGTCTGCCTAATTCTGTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Genome-wide association study confirms SNPs in SNCA and the MAPT region as common risk factors for Parkinson disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link