zgc:194598

Ensembl ID:
ENSDARG00000063242
ZFIN ID:
ZDB-GENE-080722-25
Description:
hypothetical protein LOC100170789 [Source:RefSeq peptide;Acc:NP_001124099]
Human Orthologue:
TTC13
Human Description:
tetratricopeptide repeat domain 13 [Source:HGNC Symbol;Acc:26204]
Mouse Orthologue:
Ttc13
Mouse Description:
tetratricopeptide repeat domain 13 Gene [Source:MGI Symbol;Acc:MGI:2384573]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14655 Nonsense Available for shipment Available now
sa36952 Essential Splice Site Available for shipment Available now
sa43373 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092217 Nonsense 97 825 3 24
Genomic Location (Zv9):
Chromosome 20 (position 4097771)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4040040
GRCz11 20 3991569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCTCCCTCTTTCTTTCACMRCAGAATCAGGCAAAGYTGTTTGTCGAA[C/T]AGCGGCGGTTTCCTTWCGCTGTGGACAACCAAAATACCAATGAAGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092217 Essential Splice Site 293 825 10 24
Genomic Location (Zv9):
Chromosome 20 (position 4105668)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4047347
GRCz11 20 3984551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTCGGACTTTATAGATGCTTATAAAAGCTTGGGTCAGGCTTACAGG[T/C]AAGGTGACTCTGTCAGTTCTGTCAGATATCTAGATTTTGTCGGATCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092217 Essential Splice Site 451 825 13 24
Genomic Location (Zv9):
Chromosome 20 (position 4114100)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4055779
GRCz11 20 3976119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCATAGAAGACTACGAAGAACAGCCTGGACTTCAGCCGCATATTAA[G/A]TGAGTGTAAAAGACGAGTCTCTTCAGTCTTTTTAGTGTTTGAACATTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link