
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
BAZ1A (2 of 2)
- Ensembl ID:
- ENSDARG00000063233
- Description:
- bromodomain adjacent to zinc finger domain, 1A [Source:HGNC Symbol;Acc:960]
- Human Orthologue:
- BAZ1A
- Human Description:
- bromodomain adjacent to zinc finger domain, 1A [Source:HGNC Symbol;Acc:960]
- Mouse Orthologue:
- Baz1a
- Mouse Description:
- bromodomain adjacent to zinc finger domain 1A Gene [Source:MGI Symbol;Acc:MGI:1309478]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42873 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9543 | Nonsense | Available for shipment | Available now |
sa14102 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42873
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092209 | Nonsense | 225 | 722 | 3 | 17 |
- Genomic Location (Zv9):
- Chromosome 17 (position 9907754)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 9886926 GRCz11 17 10042970 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGGTGATGGAGAGAAACTCATGGCGAGCTGCGCTCGAAAATGGGAACTA[T/G]GAACTATTAGACCCTGACTTCAAAGAGTATGGGCTAACTGACCGAGAAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9543
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092209 | Nonsense | 465 | 722 | 9 | 17 |
- Genomic Location (Zv9):
- Chromosome 17 (position 9902180)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 9881352 GRCz11 17 10037396 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACTTCCTCTACAGAACAATAAAGGAGGTYGTTCGAACAGCAAATCAAAA[C/T]AAGCTGAATCCGCTAATTCCACGTCCCGCTCGCAGCAGAACACACCCAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14102
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092209 | Essential Splice Site | 549 | 722 | 13 | 17 |
- Genomic Location (Zv9):
- Chromosome 17 (position 9900782)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 9879954 GRCz11 17 10035998 - KASP Assay ID:
- 2261-0671.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAAAATATCTNNYAATGTCAGATTTTTYCAATATCTTGCWGCCCTAATTGA[T/A]GTCATGCAAACMTTTTATTTCAAACTTCAGTTAYTTCACAKGTGAGATTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: