
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bmp7b
- Ensembl ID:
- ENSDARG00000063230
- ZFIN ID:
- ZDB-GENE-060929-328
- Description:
- bone morphogenetic protein 7 [Source:RefSeq peptide;Acc:NP_001070614]
- Human Orthologue:
- BMP7
- Human Description:
- bone morphogenetic protein 7 [Source:HGNC Symbol;Acc:1074]
- Mouse Orthologue:
- Bmp7
- Mouse Description:
- bone morphogenetic protein 7 Gene [Source:MGI Symbol;Acc:MGI:103302]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37612 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa17005 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37612
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092214 | Essential Splice Site | 248 | 427 | 3 | 8 |
ENSDART00000138020 | Essential Splice Site | 248 | 427 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 23 (position 6494190)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 6509405 GRCz11 23 6443377 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCCGGGCCGTAACCTGGGCCTGCAGCTGGCTCTGGACAGTCTGGACGG[T/A]GAGCAAAATGAGCAATGCATTCACAAATCTGCCATTCAGAGAGCACGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17005
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092214 | Nonsense | 267 | 427 | 4 | 8 |
ENSDART00000138020 | Nonsense | 267 | 427 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 23 (position 6488739)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 6503954 GRCz11 23 6437926 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGTGAACCCCTGGGTGGCGGGACTGGTGGGGCGCAGTGGCCCTCAGAGC[A/T]AACAGCCCTTCATGGTGGCCTTCTTCAAAGCCACGGAGGTCCACATCCGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Response to citalopram treatment: A genomewide association study of citalopram response in major depressive disorder. (View Study)
- White blood cell types: Identification of nine novel loci associated with white blood cell subtypes in a Japanese population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: