
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
xpo1
- Ensembl ID:
- ENSDARG00000063229
- ZFIN ID:
- ZDB-GENE-070530-6
- Human Orthologue:
- XPO1
- Human Description:
- exportin 1 (CRM1 homolog, yeast) [Source:HGNC Symbol;Acc:12825]
- Mouse Orthologue:
- Xpo1
- Mouse Description:
- exportin 1, CRM1 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2144013]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10716 | Nonsense | Available for shipment | Available now |
sa7435 | Missense | Mutation detected in F1 DNA | During 2018 |
sa42931 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa7436 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa10716
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092188 | Nonsense | 78 | 1074 | 3 | 24 |
- Genomic Location (Zv9):
- Chromosome 17 (position 23801485)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 23954927 GRCz11 17 23973328 - KASP Assay ID:
- 2261-1044.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAGCTYGGGTCATTAATGCTTGATTTGYTCTCTTGGCATTACAGYACTA[T/A]GCTCTGCAGATTCTGGAAACAGTTATTAAAACAAGATGGAAGATTCTGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7435
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092188 | Missense | 459 | 1074 | 12 | 24 |
- Genomic Location (Zv9):
- Chromosome 17 (position 23804256)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 23957698 GRCz11 17 23976099 - KASP Assay ID:
- 554-4130.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTTCGAGAATTCAKGAAGGATACAGACTCCATTAATCTATACAAGAACA[T/G]GAGGGAGACACTTGGTGAGAACTTAGTCATTCTTCACTTTTAATGCAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42931
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092188 | Nonsense | 508 | 1074 | 13 | 24 |
- Genomic Location (Zv9):
- Chromosome 17 (position 23804507)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 23957949 GRCz11 17 23976350 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTCCTGGAAGAACCTAAACACACTGTGCTGGGCCATTGGTTCCATTAGT[G/T]GAGCCATGCATGAGGAAGATGAGAAGCGGTTCCTCGTCACAGTCATAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7436
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092188 | Missense | 642 | 1074 | 16 | 24 |
- Genomic Location (Zv9):
- Chromosome 17 (position 23805823)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 23959265 GRCz11 17 23977666 - KASP Assay ID:
- 554-4131.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACCATTTCCTGTTTTCAGGTGCACACGTTTTACGAAGCTGTTGGGTATA[T/G]GATTGGAGCGCAGACCGACCAGGCTGTGCAGGAACACCTGATAGAGAAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: