ubap2l

Ensembl ID:
ENSDARG00000063219
ZFIN ID:
ZDB-GENE-060503-244
Description:
ubiquitin-associated protein 2-like [Source:RefSeq peptide;Acc:NP_001076535]
Human Orthologue:
UBAP2L
Human Description:
ubiquitin associated protein 2-like [Source:HGNC Symbol;Acc:29877]
Mouse Orthologue:
Ubap2l
Mouse Description:
ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32231 Essential Splice Site Available for shipment Available now
sa43218 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36779 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36780 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43219 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092112 Essential Splice Site 200 1144 6 27
ENSDART00000092138 Essential Splice Site 200 1196 6 28
Genomic Location (Zv9):
Chromosome 19 (position 8387974)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7846513
GRCz11 19 7765438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGGAGCTGGAAGGCGAGGAGGGAGGTTTTCAGCTCAGGGCATGGGG[T/A]AAGTTTGTGTGACTCCACTCAGGTTCTTGCCCTTTTTGCATGTGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092112 Essential Splice Site 714 1144 17 27
ENSDART00000092138 Essential Splice Site 714 1196 17 28
Genomic Location (Zv9):
Chromosome 19 (position 8402166)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7860705
GRCz11 19 7779630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCATGAAGACGTCTCGCCCAGCTCATTGGCCACTCAGCACAACAAG[T/G]ATGATGTCTTTCATTAAATTAGTTTAGTATCATCCGATTTAGAGAGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092112 Essential Splice Site 736 1144 18 27
ENSDART00000092138 Essential Splice Site 736 1196 18 28
Genomic Location (Zv9):
Chromosome 19 (position 8402321)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7860860
GRCz11 19 7779785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGTTTGGCACCTTCTTCAGTTCGCACTTCAAACACAAGTCTGCTGG[T/C]GAGTTTATTGTAAAATACTCTATATGAATTTAGATATCAAATAAAATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092112 Essential Splice Site 871 1144 20 27
ENSDART00000092138 Essential Splice Site 871 1196 20 28
Genomic Location (Zv9):
Chromosome 19 (position 8407243)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7865782
GRCz11 19 7784707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCCCAACCCTTACATTATGGCTCCTGGCCTGCTTCACCCATACCCAG[T/C]GAGTGTTTAGTGATGCATGTTATTTTTTGCTGCTTTCAATCCTGCACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092112 Essential Splice Site 1048 1144 25 27
ENSDART00000092138 Essential Splice Site 1100 1196 26 28
Genomic Location (Zv9):
Chromosome 19 (position 8417221)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7875760
GRCz11 19 7794685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACACGGGAGTCCCTGATATTTCAGGCTCTGTTTACACAAAGACGCAG[G/A]TGAGCAGTTGCATTGAACACTGCTTTATTAAGCTGTAGCCAGCGGTTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link