si:dkey-246l19.1

Ensembl ID:
ENSDARG00000063197
ZFIN IDs:
ZDB-GENE-081030-1, ZDB-GENE-081030-1, ZDB-GENE-081030-1, ZDB-GENE-081104-389
Description:
Golgin subfamily A member 2 [Source:RefSeq peptide;Acc:NP_001120806]
Human Orthologues:
AC010724.3, AC011295.4, AC011467.1, AC011467.3, AC019294.1, AC019294.3, AC019322.1, AC026150.1, AC055876.1, AC090825.2, AC100756.1, AC104758.1, AC104758.3, AC107977.1, AC123768.3, AC126323.1, AC126323.2, GOLGA2, GOLGA6A, GOLGA6B, GOLGA6C, GOLGA6D, GOLGA6L10, GOLGA6L4, GOLGA6L9, GOLGA8A, GOLGA8B, GOLGA8C, GOLGA8DP, GOLGA8IP, GOLGA8J, RP11-632K20.1, RP13-395E19.1, RP13-98N21.1
Human Descriptions:
golgin A2 pseudogene (LOC440518), non-coding RNA [Source:RefSeq DNA;Acc:NR_033899]
golgin A2 [Source:HGNC Symbol;Acc:4425]
golgin A6 family, member A [Source:HGNC Symbol;Acc:13567]
golgin A6 family, member B [Source:HGNC Symbol;Acc:32205]
golgin A6 family, member C [Source:HGNC Symbol;Acc:32206]
golgin A6 family, member D [Source:HGNC Symbol;Acc:32204]
golgin A6 family-like 10 [Source:HGNC Symbol;Acc:37228]
golgin A6 family-like 4 [Source:HGNC Symbol;Acc:27256]
golgin A6 family-like 9 [Source:HGNC Symbol;Acc:37229]
golgin A8 family, member A [Source:HGNC Symbol;Acc:31972]
golgin A8 family, member B [Source:HGNC Symbol;Acc:31973]
golgin A8 family, member C [Source:HGNC Symbol;Acc:32375]
golgin A8 family, member D (pseudogene) [Source:HGNC Symbol;Acc:32376]
golgin A8 family, member I (pseudogene) [Source:HGNC Symbol;Acc:26660]
golgin A8 family, member J [Source:HGNC Symbol;Acc:38650]
Golgin subfamily A member 2-like protein 4 [Source:UniProtKB/Swiss-Prot;Acc:Q8N8X6]
Golgin subfamily A member 6-like protein 9 [Source:UniProtKB/Swiss-Prot;Acc:A6NEM1]
Golgin subfamily A member 8-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A6NP81]
Putative golgin subfamily A member 2-like protein 6 [Source:UniProtKB/Swiss-Prot;Acc:A8MZ06]
Putative golgin subfamily A member 6-like protein 11 [Source:UniProtKB/Swiss-Prot;Acc:A6NCC3]
Putative golgin subfamily A member 6-like protein 11 [Source:UniProtKB/Swiss-Prot;Acc:A6NCC3]
Putative golgin subfamily A member 6-like protein 11 [Source:UniProtKB/Swiss-Prot;Acc:A6NCC3]
Putative golgin subfamily A member 6-like protein 7 [Source:UniProtKB/Swiss-Prot;Acc:A6NCM5]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JUF2]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D3YTE5]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D6RF30]
Mouse Orthologue:
Golga2
Mouse Description:
golgi autoantigen, golgin subfamily a, 2 Gene [Source:MGI Symbol;Acc:MGI:2139395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20328 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092087 Nonsense 394 1028 15 27
ENSDART00000128274 Nonsense 425 1059 16 28
ENSDART00000137819 Nonsense 102 736 3 15

The following transcripts of ENSDARG00000063197 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 1773595)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 1399945
GRCz11 5 1454385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGCAGGCGGAGAGAGATCAGTACGCTGTACAGATGCAGGAGGATGGA[C/T]GAGTGTGGAAGGACAAAACAGAGCAGCTCCTGTCTCAGGTATATTTATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: A genome-wide association study identifies a susceptibility locus for refractive errors and myopia at 15q14. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link