si:dkey-60b12.3

Ensembl ID:
ENSDARG00000063191
ZFIN IDs:
ZDB-GENE-030131-3379, ZDB-GENE-060929-1122
Description:
exostosin-like 2 [Source:RefSeq peptide;Acc:NP_001070029]
Human Orthologue:
EXTL2
Human Description:
exostoses (multiple)-like 2 [Source:HGNC Symbol;Acc:3516]
Mouse Orthologue:
Extl2
Mouse Description:
exostoses (multiple)-like 2 Gene [Source:MGI Symbol;Acc:MGI:1889574]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31255 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092116 Nonsense 51 332 2 5
Genomic Location (Zv9):
Chromosome 2 (position 6834448)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7258018
GRCz11 2 7129624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTTACTGCCCAACAATGAAGACATCAATATTCTCCGAGAGCTCCGA[C/T]GAAGCTCCAACACCTCACGAACCCTGGCGGACCCAGAGGAGAGCTTTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link