zgc:154071

Ensembl ID:
ENSDARG00000063187
ZFIN ID:
ZDB-GENE-060929-914
Description:
1-acyl-sn-glycerol-3-phosphate acyltransferase epsilon [Source:RefSeq peptide;Acc:NP_001070213]
Human Orthologue:
AGPAT5
Human Description:
1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) [Sou
Mouse Orthologue:
Agpat5
Mouse Description:
1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) Gene

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42134 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092105 Nonsense 167 365 5 8
Genomic Location (Zv9):
Chromosome 13 (position 6269101)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6140035
GRCz11 13 6268495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCATAACAGTTTATTTTTTAATTGGTTGTTTTCCTGCACAGATGTA[T/A]CTTGTCATCTTCCCAGAGGGAACCCGCTACAACCCTGAGCTAAAGAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link