zgc:171747

Ensembl ID:
ENSDARG00000063169
ZFIN ID:
ZDB-GENE-070928-28
Description:
ubinuclein 1 [Source:RefSeq peptide;Acc:NP_001098588]
Human Orthologue:
UBN1
Human Description:
ubinuclein 1 [Source:HGNC Symbol;Acc:12506]
Mouse Orthologue:
Ubn1
Mouse Description:
ubinuclein 1 Gene [Source:MGI Symbol;Acc:MGI:1891307]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19430 Essential Splice Site Available for shipment Available now
sa8896 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092071 Essential Splice Site 147 827 3 16
ENSDART00000114876 Essential Splice Site 17 315 3 8
ENSDART00000132812 Essential Splice Site 17 148 3 6
Genomic Location (Zv9):
Chromosome 1 (position 8352422)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8592227
GRCz11 1 9276338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCTTTGGTTACGATGAGTCCGATTCATTCATTGATAACTCTGAGGCT[G/A]TGAGTTCTGGCCAGTCTTTGTATATCCAGATGATATTATAGAATATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092071 Essential Splice Site 480 827 10 16
ENSDART00000114876   None 315 None 8
ENSDART00000132812   None 148 None 6
Genomic Location (Zv9):
Chromosome 1 (position 8341986)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8581791
GRCz11 1 9265902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCACTCTGMTTGTRTTGTTATATTTGWGTGTTCTTCTGTGTGCTTTAA[G/A]ACTCGAGGCTGAGAAAGAGCGAGYGATTGATGGATCTGATGAGGAAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link