si:dkey-32e23.4

Ensembl ID:
ENSDARG00000063159
ZFIN ID:
ZDB-GENE-081105-41
Description:
Novel protein similar to H.sapiens DNM1L, dynamin 1-like (DNM1L) [Source:UniProtKB/TrEMBL;Acc:B8JIY8
Human Orthologue:
DNM1L
Human Description:
dynamin 1-like [Source:HGNC Symbol;Acc:2973]
Mouse Orthologue:
Dnm1l
Mouse Description:
dynamin 1-like Gene [Source:MGI Symbol;Acc:MGI:1921256]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34505 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7622 Missense Mutation detected in F1 DNA During 2018
sa21391 Nonsense Available for shipment Available now
sa41302 Nonsense Mutation detected in F1 DNA During 2018
sa13350 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092024 Essential Splice Site 82 675 None 17
ENSDART00000137808   None 108 None 3
ENSDART00000142061 Essential Splice Site 82 479 None 11

The following transcripts of ENSDARG00000063159 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 53254755)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50997280
GRCz11 8 50986302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGGTGAACGTGCCACCTCTGGAGGAGAGACGGAAACAAGACAATGG[T/G]AACAACTCTAAAAAAATTAAATTCTTATTATTAGTTTTAGACTTGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092024 Missense 308 675 9 17
ENSDART00000137808   None 108 None 3
ENSDART00000142061 Missense 293 479 8 11

The following transcripts of ENSDARG00000063159 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 53276942)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51019467
GRCz11 8 51008489
KASP Assay ID:
554-4358.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCGGYTCYCGCTATCTGGCTCGCACCCTGAGCCGCCTGCTCATGCAT[C/A]ACATCAGAGACTGCCTGCCGGAGCTCAAGACCCGKGTCACGGTGCTCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092024 Nonsense 409 675 10 17
ENSDART00000137808   None 108 None 3
ENSDART00000142061 Nonsense 394 479 9 11

The following transcripts of ENSDARG00000063159 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 53282830)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51025355
GRCz11 8 51014377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTGACCCACTTGGAGGACTCACTGAGCTCGATATTCTCACAGCTATT[C/T]GAAATGCTACGGTATAATGTTTACATGGTTTTGCATGCGTGTGTGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092024 Nonsense 578 675 15 17
ENSDART00000137808 Nonsense 11 108 1 3
ENSDART00000142061   None 479 None 11

The following transcripts of ENSDARG00000063159 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 53290095)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51032620
GRCz11 8 51021642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGCTCATGTTTCTGCAGGCCGTGCCAGTATCGCGCAAACTGAGCTCT[C/T]GAGAGCAGCGGGACTGTGAGGTGATCCAGAGACTCATCAAATGCTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092024 Essential Splice Site 657 675 16 17
ENSDART00000137808 Essential Splice Site 90 108 2 3
ENSDART00000142061   None 479 None 11

The following transcripts of ENSDARG00000063159 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 53291589)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51034114
GRCz11 8 51023136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTCTCAGGAAACAGCACAGCAGCGCACTGAGGTCGCACACATGCTGGAGG[T/C]ACGTCAAAATGGRCAGTATTATCAGGGGAAATCGAATTGGCACAAAAMAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link