
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dcaf12
- Ensembl ID:
- ENSDARG00000063155
- ZFIN ID:
- ZDB-GENE-061013-363
- Description:
- DDB1- and CUL4-associated factor 12 [Source:UniProtKB/Swiss-Prot;Acc:Q08BB3]
- Human Orthologues:
- DCAF12, DCAF12L1, DCAF12L2
- Human Descriptions:
- DDB1 and CUL4 associated factor 12 [Source:HGNC Symbol;Acc:19911]
- DDB1 and CUL4 associated factor 12-like 1 [Source:HGNC Symbol;Acc:29395]
- DDB1 and CUL4 associated factor 12-like 2 [Source:HGNC Symbol;Acc:32950]
- Mouse Orthologues:
- Dcaf12, Dcaf12l1, Dcaf12l2
- Mouse Descriptions:
- DDB1 and CUL4 associated factor 12 Gene [Source:MGI Symbol;Acc:MGI:1916220]
- DDB1 and CUL4 associated factor 12-like 1 Gene [Source:MGI Symbol;Acc:MGI:2444462]
- DDB1 and CUL4 associated factor 12-like 2 Gene [Source:MGI Symbol;Acc:MGI:2445178]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14363 | Nonsense | Available for shipment | Available now |
sa23871 | Nonsense | Available for shipment | Available now |
sa45730 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa14363
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092015 | Nonsense | 325 | 482 | 7 | 9 |
ENSDART00000133227 | None | 52 | None | 1 |
- Genomic Location (Zv9):
- Chromosome 21 (position 10329815)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 11813178 GRCz11 21 11905806 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AYTTTGTGTTCTGTGANTTTTTCAGGAGCTTTCTACAAAACTCCCTTACTG[T/A]AAGGAGAATGTTTGTCTGGCTTACGGGCYGGACTGGTCTGTTTATGCAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23871
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092015 | Nonsense | 340 | 482 | 7 | 9 |
ENSDART00000133227 | None | 52 | None | 1 |
- Genomic Location (Zv9):
- Chromosome 21 (position 10329860)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 11813223 GRCz11 21 11905851 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACTGTAAGGAGAATGTTTGTCTGGCTTACGGGCTGGACTGGTCTGTTTA[T/A]GCAGTCGGTTCTCAGGCACACGTTTCCTTCCTCGACCCCCGGCAATCTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45730
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000092015 | Nonsense | 455 | 482 | 9 | 9 |
ENSDART00000133227 | Nonsense | 25 | 52 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 21 (position 10335597)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 11818960 GRCz11 21 11911588 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACTTTTCCGACATCCGCTCGTTCCCGAACGCTGTGTACACGCACTGCTA[T/A]GACGACTCCGGCACCAAGCTCTTCGTAGCCGGCGGCCCGCTGTGTTCGGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: