dcaf12

Ensembl ID:
ENSDARG00000063155
ZFIN ID:
ZDB-GENE-061013-363
Description:
DDB1- and CUL4-associated factor 12 [Source:UniProtKB/Swiss-Prot;Acc:Q08BB3]
Human Orthologues:
DCAF12, DCAF12L1, DCAF12L2
Human Descriptions:
DDB1 and CUL4 associated factor 12 [Source:HGNC Symbol;Acc:19911]
DDB1 and CUL4 associated factor 12-like 1 [Source:HGNC Symbol;Acc:29395]
DDB1 and CUL4 associated factor 12-like 2 [Source:HGNC Symbol;Acc:32950]
Mouse Orthologues:
Dcaf12, Dcaf12l1, Dcaf12l2
Mouse Descriptions:
DDB1 and CUL4 associated factor 12 Gene [Source:MGI Symbol;Acc:MGI:1916220]
DDB1 and CUL4 associated factor 12-like 1 Gene [Source:MGI Symbol;Acc:MGI:2444462]
DDB1 and CUL4 associated factor 12-like 2 Gene [Source:MGI Symbol;Acc:MGI:2445178]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14363 Nonsense Available for shipment Available now
sa23871 Nonsense Available for shipment Available now
sa45730 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092015 Nonsense 325 482 7 9
ENSDART00000133227   None 52 None 1
Genomic Location (Zv9):
Chromosome 21 (position 10329815)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11813178
GRCz11 21 11905806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYTTTGTGTTCTGTGANTTTTTCAGGAGCTTTCTACAAAACTCCCTTACTG[T/A]AAGGAGAATGTTTGTCTGGCTTACGGGCYGGACTGGTCTGTTTATGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092015 Nonsense 340 482 7 9
ENSDART00000133227   None 52 None 1
Genomic Location (Zv9):
Chromosome 21 (position 10329860)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11813223
GRCz11 21 11905851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGTAAGGAGAATGTTTGTCTGGCTTACGGGCTGGACTGGTCTGTTTA[T/A]GCAGTCGGTTCTCAGGCACACGTTTCCTTCCTCGACCCCCGGCAATCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092015 Nonsense 455 482 9 9
ENSDART00000133227 Nonsense 25 52 1 1
Genomic Location (Zv9):
Chromosome 21 (position 10335597)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11818960
GRCz11 21 11911588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTTCCGACATCCGCTCGTTCCCGAACGCTGTGTACACGCACTGCTA[T/A]GACGACTCCGGCACCAAGCTCTTCGTAGCCGGCGGCCCGCTGTGTTCGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link