
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-60i13.2
- Ensembl ID:
- ENSDARG00000063141
- ZFIN ID:
- ZDB-GENE-030131-7119
- Description:
- Novel protein similar to vertebrate R3H domain containing 1 (R3HDM1) [Source:UniProtKB/TrEMBL;Acc:B8
- Human Orthologue:
- R3HDM1
- Human Description:
- R3H domain containing 1 [Source:HGNC Symbol;Acc:9757]
- Mouse Orthologue:
- R3hdm1
- Mouse Description:
- R3H domain 1 (binds single-stranded nucleic acids) Gene [Source:MGI Symbol;Acc:MGI:2448514]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37455 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24103 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37455
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091982 | Nonsense | 395 | 1028 | 11 | 23 |
ENSDART00000146322 | Nonsense | 50 | 729 | 1 | 13 |
The following transcripts of ENSDARG00000063141 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 12496022)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 12341885 GRCz11 22 12366662 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCCTGTGGCCCCTCATCCCTCTGCACCCATAGGGGGCAGCGCAGCCTCT[C/T]AGAGCAGCACTACTAACGCTAACATTAACGCTAACGCTAGCTTCTACATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24103
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091982 | None | 1028 | None | 23 | |
ENSDART00000146322 | Essential Splice Site | 587 | 729 | 11 | 13 |
The following transcripts of ENSDARG00000063141 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 12516378)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 12362241 GRCz11 22 12387018 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCTCATGTGGTCAACCACCACCATCATCACCATCTTCATCACCACCAG[G/A]TTGAACACGCACACACACTCTCACTCACTCATGATCGCACACATCCAGCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: