eif2c3

Ensembl ID:
ENSDARG00000063079
ZFIN ID:
ZDB-GENE-060503-452
Description:
Protein argonaute-3 [Source:UniProtKB/Swiss-Prot;Acc:A3KPK0]
Human Orthologue:
EIF2C3
Human Description:
eukaryotic translation initiation factor 2C, 3 [Source:HGNC Symbol;Acc:18421]
Mouse Orthologue:
Eif2c3
Mouse Description:
eukaryotic translation initiation factor 2C, 3 Gene [Source:MGI Symbol;Acc:MGI:2446634]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17616 Nonsense Available for shipment Available now
hu2484 Nonsense Available for shipment Available now
sa23461 Essential Splice Site Available for shipment Available now
sa23462 Nonsense Available for shipment Available now
sa43240 Nonsense Mutation detected in F1 DNA During 2018
sa44906 Nonsense Mutation detected in F1 DNA During 2018
sa39235 Nonsense Mutation detected in F1 DNA During 2018
sa23463 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091813 Nonsense 49 860 2 19
ENSDART00000091813 Nonsense 49 860 2 19
Genomic Location (Zv9):
Chromosome 19 (position 11289237)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10748466
GRCz11 19 10667391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCCAACTGCTTTCAGGTGGACATCCCCAAGATGGATGTCTACCTGTA[C/A]GATGTSGACATCAAGCCAGAAAAGTGCCCAMGRCGTGTTAACAGGTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091813 Nonsense 49 860 2 19
ENSDART00000091813 Nonsense 49 860 2 19
Genomic Location (Zv9):
Chromosome 19 (position 11289237)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10748466
GRCz11 19 10667391
KASP Assay ID:
554-0088.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCCAACTGCTTTCAGGTGGACATCCCCAAGATGGATGTCTACCTGTA[C/A]GATGTGGACATCAAGCCAGAAAAGTGCCCACGACGTGTTAACAGGTGCAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091813 Essential Splice Site 264 860 6 19
Genomic Location (Zv9):
Chromosome 19 (position 11293602)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10752831
GRCz11 19 10671756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCCTCTCACCGATTCCCACAGAGTCAAATTCACCAAAGAGATCAAAG[G/A]TTAGTGTCAATGGGCAAAAGTGGCTATAAAGATTGTTCAAACTCTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091813 Nonsense 342 860 8 19
Genomic Location (Zv9):
Chromosome 19 (position 11295138)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10754367
GRCz11 19 10673292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCCCTGCCTGCAAGTGGGACAGGAGCAGAAACACACATACCTACCTT[T/A]AGAGGTGAGGCGTCTGATAACTTATGTTAACAGGAAACGTGATGCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091813 Nonsense 377 860 9 19
Genomic Location (Zv9):
Chromosome 19 (position 11296218)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10755447
GRCz11 19 10674372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAACCTCCACCATGATCAAAGCCACGGCCCGCTCCGCACCGGACAGA[C/T]AAGAGGAGATCAGCAGACTGGTGAGTCCTAAAAGATACTCAGAAACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091813 Nonsense 462 860 11 19
Genomic Location (Zv9):
Chromosome 19 (position 11299112)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10758341
GRCz11 19 10677266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTGGAGATCAAGATGTGGGCCATCGCTTGCTTTGCCACTCAGAGA[C/T]AATGTAGAGAGGAAGTTCTCAAGTAAAGCTTCCTCCATCTTTTTTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091813 Nonsense 637 860 15 19
Genomic Location (Zv9):
Chromosome 19 (position 11303218)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10762447
GRCz11 19 10681372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTCACCCCAGCAGATACTGCGCTACCGTCCGTGTCCAGAGGCCCAGA[C/T]AGGAGGTGATTCAGGACCTGGCATCCATGGTGCGAGAGCTGCTCATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091813 Essential Splice Site 825 860 19 19
Genomic Location (Zv9):
Chromosome 19 (position 11307216)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10766445
GRCz11 19 10685370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCATTGTTTAAGTAATTTGCTAATTTCTCTCTCCTCTTTTCACACA[G/A]TGCGGAAGGCAGCCATGTGTCGGGTCAGAGTAACGGTCGAGACCCTCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link