
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gripap1
- Ensembl ID:
- ENSDARG00000063069
- ZFIN ID:
- ZDB-GENE-070112-922
- Description:
- GRIP1-associated protein 1 isoform 1 [Source:RefSeq peptide;Acc:NP_001116792]
- Human Orthologue:
- GRIPAP1
- Human Description:
- GRIP1 associated protein 1 [Source:HGNC Symbol;Acc:18706]
- Mouse Orthologue:
- Gripap1
- Mouse Description:
- GRIP1 associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1859616]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa402 | Essential Splice Site | Available for shipment | Available now |
sa34312 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31629 | Essential Splice Site | Available for shipment | Available now |
sa16570 | Nonsense | Available for shipment | Available now |
sa34313 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa402
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111853 | Essential Splice Site | 102 | 867 | 5 | 28 |
ENSDART00000139414 | None | 194 | None | 8 |
The following transcripts of ENSDARG00000063069 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 10252408)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 9668990 GRCz11 8 9707575 - KASP Assay ID:
- 554-0369.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGATGATTTCAGACTGCAGAACAGCACCCTCATGCAAGAGCTGTCCAAGG[T/C]GCTTTCATTATCATGAACATGTCAACACTGTAACTTTATGCACAAATGTA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa34312
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111853 | Nonsense | 388 | 867 | 16 | 28 |
ENSDART00000139414 | Nonsense | 140 | 194 | 7 | 8 |
The following transcripts of ENSDARG00000063069 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 10276062)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 9692644 GRCz11 8 9731229 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCACAGATCCAAACAGTGAAGACTCAGGAACTGAATTTGCTGAGAGAG[C/T]AAAATCTTGCGCTGAACGCCGAGCTTCAGCAGAGACGTACTGACCAGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31629
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111853 | Essential Splice Site | 785 | 867 | 26 | 28 |
ENSDART00000139414 | None | 194 | None | 8 |
The following transcripts of ENSDARG00000063069 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 10305985)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 9722567 GRCz11 8 9761152 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTAAAAAAAGCGCAATTATTGAGACGTACGTCATGGACAGCCGGAGAGG[T/C]AAAGCAGCTTTTCTCCATCCCTCTTTTGTCATTGTTCGCAGCCTCTTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16570
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111853 | Nonsense | 791 | 867 | 27 | 28 |
ENSDART00000139414 | None | 194 | None | 8 |
The following transcripts of ENSDARG00000063069 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 10326617)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 9743199 GRCz11 8 9781784 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCATCTTTCTGTTTTTTTTTTTTTATATCTCAGATGTATCAGGAGGTGTT[G/T]GATTGGCTCATAGTGCTCAGCCKGACCGTGGAGRTTTGAGTTCGGTTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34313
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111853 | Essential Splice Site | 841 | 867 | 27 | 28 |
ENSDART00000139414 | None | 194 | None | 8 |
The following transcripts of ENSDARG00000063069 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 10326771)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 9743353 GRCz11 8 9781938 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGAACATGCTGGAGGAACAACTGACAAAGAACATGCACCTACAGAAGG[T/G]AAAGAAAGAGATGAACAGCTACGGTTGAAGTCAGAATTATTAGCCCTCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: