SYNE1 (1 of 2)

Ensembl ID:
ENSDARG00000063068
Description:
spectrin repeat containing, nuclear envelope 1 [Source:HGNC Symbol;Acc:17089]
Human Orthologue:
SYNE1
Human Description:
spectrin repeat containing, nuclear envelope 1 [Source:HGNC Symbol;Acc:17089]
Mouse Orthologue:
Syne1
Mouse Description:
synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]

Alleles

There are 34 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14682 Nonsense Available for shipment Available now
sa16903 Nonsense Available for shipment Available now
sa9773 Nonsense Available for shipment Available now
sa12762 Nonsense Available for shipment Available now
sa36319 Nonsense Mutation detected in F1 DNA During 2018
sa18036 Nonsense Available for shipment Available now
sa10324 Nonsense Available for shipment Available now
sa30694 Nonsense Mutation detected in F1 DNA During 2018
sa32120 Nonsense Available for shipment Available now
sa28806 Nonsense Mutation detected in F1 DNA During 2018
sa11808 Nonsense Available for shipment Available now
sa28805 Nonsense Mutation detected in F1 DNA During 2018
sa36318 Nonsense Mutation detected in F1 DNA During 2018
sa28804 Essential Splice Site Mutation detected in F1 DNA During 2018
sa28803 Nonsense Mutation detected in F1 DNA During 2018
sa42869 Nonsense Mutation detected in F1 DNA During 2018
sa11059 Nonsense Available for shipment Available now
sa9065 Nonsense Mutation detected in F1 DNA During 2018
sa13399 Nonsense Available for shipment Available now
sa7444 Missense Mutation detected in F1 DNA During 2018
sa11274 Nonsense Available for shipment Available now
sa36317 Nonsense Mutation detected in F1 DNA During 2018
sa11252 Nonsense Available for shipment Available now
sa8519 Nonsense Mutation detected in F1 DNA During 2018
sa32119 Essential Splice Site Available for shipment Available now
sa8895 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7443 Missense Mutation detected in F1 DNA During 2018
sa8603 Nonsense Mutation detected in F1 DNA During 2018
sa10495 Nonsense Available for shipment Available now
sa13678 Nonsense Available for shipment Available now
sa45593 Nonsense Mutation detected in F1 DNA During 2018
sa11189 Nonsense Available for shipment Available now
sa2927 Nonsense F2 line generated During 2018
sa14747 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 335 8759 9 143
Genomic Location (Zv9):
Chromosome 17 (position 7942610)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7945384
GRCz11 17 8102562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGATGTACTGYGGGCACAGGGATCTGAAGAGAGTCTCACTGACAAATA[T/G]CAGGTCAACTTTGGAATTAAACAGGCTGTTTTGTCACTTTYAGTGCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 452 8759 12 143
Genomic Location (Zv9):
Chromosome 17 (position 7937432)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7940206
GRCz11 17 8097384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGCAGGAGGTGTTAAAGAACTTGGAGGSACACAGACAGACATTTCAG[C/T]AGATTCACAGAGACCGATCRGTAAACGGTGTACCRGTACCACCAGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 1034 8759 23 143
Genomic Location (Zv9):
Chromosome 17 (position 7915070)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7917844
GRCz11 17 8075022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATCMCTGCAGGAGTGTCAGGCCGAACTGGCCCGCGAAAACCGCAGTT[T/A]GCCCAGYGTCGGCAGCGAGAGGTTAATTAAAGAGCACCGRGTGAGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 1469 8759 31 143
Genomic Location (Zv9):
Chromosome 17 (position 7906145)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7908919
GRCz11 17 8066097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAAGAGAAATGGATGCCTTAAAAAGCTCCAGCATACCTTTGGACCAG[C/T]AGATCTGTACTGTACAGGTGCRAAAATGTATATTTTATTGCAAATTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 1682 8759 35 143
Genomic Location (Zv9):
Chromosome 17 (position 7897078)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7899852
GRCz11 17 8057030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCCTGACAGTCAGTCTCTGCCAGTCGACAAACTAAAGCTGGATGGA[G/T]AATTGCTGGAACTAAAAGTAATACGTTTTTAAAACATTATTCACAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 1813 8759 38 143
Genomic Location (Zv9):
Chromosome 17 (position 7892974)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7895748
GRCz11 17 8052926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAGAAGCTCTCCTRAAGCAAAGCATCGTCCGGCAGAATCTTCMGCAG[C/T]AAACTAAAACCCTGTGTGAYGTTTGTGAGCCAGCKGAAGTCCAGCATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 1956 8759 38 143
Genomic Location (Zv9):
Chromosome 17 (position 7892545)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7895319
GRCz11 17 8052497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCTTGAGCGCTGARTTGGAYGCCGTGAGRAACCTACTGGGCTCCAAA[C/T]AAAGCGAAGCTGAGGCTCTCGGTGCTCTTTGGAGCTCCTTYAGACAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 2029 8759 39 143
Genomic Location (Zv9):
Chromosome 17 (position 7889005)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7891779
GRCz11 17 8048957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCTCCAGTCTCACCAGCATGAGGAGCAGTGGCTCAGGGATAAAGGT[C/T]AACAGCTCGCTCACAGAGATGCTGAGCTGGGCAGTGAAGTGCTAAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 2045 8759 39 143
Genomic Location (Zv9):
Chromosome 17 (position 7888957)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7891731
GRCz11 17 8048909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAACAGCTCGCTCACAGAGATGCTGAGCTGGGCAGTGAAGTGCTAAGA[G/T]AGATTAACCTGCTTCAGACTACCTGGGAGGACACTAAGAAACTCATTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 2070 8759 40 143
Genomic Location (Zv9):
Chromosome 17 (position 7887813)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7890587
GRCz11 17 8047765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGATGTTGCTACATGATTTTGTTGCAGACAAGAGCAAAGCAGTGCTT[T/A]AGTAGACCTCATGAAAGACTACCAGACTCTGAAGTCTTCAATAAACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 2511 8759 48 143
Genomic Location (Zv9):
Chromosome 17 (position 7880530)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7883304
GRCz11 17 8040482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAATCTAAATTAAAWCCTGTGTTKGTTTTGTAGGTTTGACGGCCGTCTG[C/T]AGAGACTGAGCCGCTGGCTGGAACGCATGGATGTGAARATGAGCACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 2746 8759 51 143
Genomic Location (Zv9):
Chromosome 17 (position 7872866)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7875640
GRCz11 17 8032818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCAGTGGCTGGAGATGGTGGAGCAGGAGGCAGGAGTGGCTCTACCT[C/T]AGCAGCCCGGGCTGAAAGAGAAAGCCGCTCTGCTGGAGAGACTACGGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 3089 8759 55 143
Genomic Location (Zv9):
Chromosome 17 (position 7864535)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7867309
GRCz11 17 8024487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGTGTTTTGACGTGCCTCAGAATCTGGCTGAGGCATCGTCCAGCCTG[C/T]AGAAGATCCAGGTAACGTTTTATCGATTTCTCATTTTTGTTTGGTCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Essential Splice Site 4012 8759 71 143
Genomic Location (Zv9):
Chromosome 17 (position 7834480)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7837254
GRCz11 17 7994432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTACCCTTTGTCACATAATCCAGAGTAATGTTTGCCCTTTGTCTCTTC[A/T]GGTGTATCAGAGTCTGGACCGTGAGCTCCAGAAGCACGTCAGCCATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 4070 8759 72 143
Genomic Location (Zv9):
Chromosome 17 (position 7831626)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7834400
GRCz11 17 7991578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGTAACGCTTTACTCCACAGGTGAAACACTTCAGGGCCCTACAGGAG[C/T]AGGCCAGCACGTACCTAGATCTGGTTTGTTCAGTGTGTGATTTATCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 4282 8759 75 143
Genomic Location (Zv9):
Chromosome 17 (position 7826460)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7829234
GRCz11 17 7986412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTCAGTTGTTCTTAAAGACAAGAAAAGCACACTTGAGGATCTCAAA[G/T]AGCAGAAGCAAAAAGTAATGTACCATCTAAACCTGGATGACAAAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 4337 8759 75 143
Genomic Location (Zv9):
Chromosome 17 (position 7826293)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7829067
GRCz11 17 7986245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAGGACTCCATTTTGACACTTGAAGACATGGGGCAAGTCGAGGCCYG[T/A]TTGAGGGAAGCTCGTGAATGGGCCGAGGAGCAGCAGCCGACTCTGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 4499 8759 75 143
Genomic Location (Zv9):
Chromosome 17 (position 7825807)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7828581
GRCz11 17 7985759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATCCAGAGCAGTTTKAGAGCCTACCAGAGTGAGCTGACCTCCCTGTG[G/A]TCACAAGGCAGGGATCTGATGAAAGATGCTTCTGAAGARGAGAAGACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 4608 8759 75 143
Genomic Location (Zv9):
Chromosome 17 (position 7825482)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7828256
GRCz11 17 7985434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGATATTGGATCAAGCTATGGAATTTGAGAACCTCCTGCTAACTGTG[C/T]AAAGGACAGGTCAAGAGATACTTCCCACTCTCAATGAAGTAGACCACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Missense 4813 8759 75 143
Genomic Location (Zv9):
Chromosome 17 (position 7824866)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7827640
GRCz11 17 7984818
KASP Assay ID:
554-4375.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGAGAGGYTGAAGAATTATCATGCCCTAGCTGCTAGTCTTCAAGGTG[C/A]CAGCTCTCACCTCACTCGACTGATGGAGCAGATGGAHAACCTGGTATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 4981 8759 76 143
Genomic Location (Zv9):
Chromosome 17 (position 7823778)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7826552
GRCz11 17 7983730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCAATTGTTTCTTTTGTAGATTACAKTAGAGCAAGCTCTTGTCTTGTGC[C/T]AGAAGTACCACTCCAGAATGCAAGCAGCATGTGAGTGGCTTGAGGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 5016 8759 76 143
Genomic Location (Zv9):
Chromosome 17 (position 7823671)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7826445
GRCz11 17 7983623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGCAGCAGGCCAGTCTTGGGGTGGATGTAGAGAACTACGAGGAGTG[T/A]CTGAGGCAACAAGAGGACATCATGGCCACTGAGCAAGAGTTCCTGGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 5087 8759 77 143
Genomic Location (Zv9):
Chromosome 17 (position 7823382)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7826156
GRCz11 17 7983334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATACGATGCTAAYRAAGACCAATGTGATTTTTATAGCTGTGTTGCT[C/T]AGTGGAATTCTTACCAAGAAGCCAGACAGACAGTCATTGASCTGATGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 5124 8759 77 143
Genomic Location (Zv9):
Chromosome 17 (position 7823271)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7826045
GRCz11 17 7983223
KASP Assay ID:
2261-0613.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGTTAACAGAGTTTTCCACAGCCAAGGCTGCAACAAACCAGGAAGCT[G/T]AAGAGAAACTTAGGAGCCATAAGGTGAGCTTTGCATGCARAATTGTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Essential Splice Site 5131 8759 77 143
Genomic Location (Zv9):
Chromosome 17 (position 7823247)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7826021
GRCz11 17 7983199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGGCTGCAACAAACCAGGAAGCTGAAGAGAAACTTAGGAGCCATAAG[G/A]TGAGCTTTGCATGCAGAATTGTGTCTCTGAGAAAAAGAAACAATCTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Essential Splice Site 5919 8759 91 143
Genomic Location (Zv9):
Chromosome 17 (position 7795793)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7798567
GRCz11 17 7955745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCAGTTTAGATGATCTCCAGCGCTCATGGGAGACCCTGAAAAATGTG[G/A]TATGTTGATCTCRTTAAAAAYAMATTTTTGATTTGAGGTATTTGACTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Missense 6383 8759 101 143
Genomic Location (Zv9):
Chromosome 17 (position 7776224)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7778998
GRCz11 17 7936176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATTATGTCAATAGTCAYGTWTTGTTTGGCRTTKTTGTCTYACAGACT[C/A]TGGGTAAAGAAGTGACGGAGRTGACGCAGGAGGTGGGACACACTCAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 6483 8759 102 143
Genomic Location (Zv9):
Chromosome 17 (position 7775845)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7778619
GRCz11 17 7935797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGATTATCCAGAAAATGGCAGGAGTTCTTGACCACACAACAACTAAA[C/T]AGATTGAAGTAAGATTTTTTTTTTATCATCAAATATGTTTTTATTAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 6925 8759 111 143
Genomic Location (Zv9):
Chromosome 17 (position 7764448)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7767222
GRCz11 17 7924400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGTGGTTTTCCTCCTGTAGGGCTTCAGGGTGGATGTGAACTGCAAA[C/T]AGCTCACTGTGGACTTTGTKAACCAGTCAGTGCTCCAGATCAGCGGTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 7045 8759 113 143
Genomic Location (Zv9):
Chromosome 17 (position 7761339)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7764113
GRCz11 17 7921291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGTGAYGGTGAARGAGAAAGAGAGAGAGCTGGAGAGAGTGGAGGAA[C/T]AGGCCTGTGCTCTCGTCCAAAACAAGACGGACGAGGCCTGTGCTGTCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 7426 8759 120 143
Genomic Location (Zv9):
Chromosome 17 (position 7745599)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7748373
GRCz11 17 7905551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAAACTTCAGGCGCTGCTTCTCCAGCAGCAGACATTTCTGGAGAAGTG[T/A]GAGACATGGATGGAGTTCTTGGTGCAGACGGAGGAGAAACTGGCCGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 7527 8759 122 143
Genomic Location (Zv9):
Chromosome 17 (position 7741272)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7744046
GRCz11 17 7901224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGGCACAGCAGCGACGGGGCATCATCGACAGTCTCCTGCGCCAGTGG[C/T]AGCGCTACCGGGAGATGGTGGARAAGCTYCGCAAGTGGCTGCTGGAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2927
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Nonsense 7615 8759 123 143
Genomic Location (Zv9):
Chromosome 17 (position 7736400)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7739174
GRCz11 17 7896352
KASP Assay ID:
554-3320.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCTGAAGCCRTTCTACAAGAGGAGCTGCTYAACATTCAGGAGCGCTG[G/A]AGAAATGCCAAYAWCCGCCTGGACGAGCAGAAGAAGGAACTGGCCGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091828 Essential Splice Site 8065 8759 131 143
Genomic Location (Zv9):
Chromosome 17 (position 7719364)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7722138
GRCz11 17 7879316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGATAACCTGCAGAGRAGAGTGTCATCCGTCCTCCGSAGACTGAAGG[T/C]ACAGRGACTATCAATAAGATGGTAGTTAATCAGTCTTGAGTTCAACACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link