ubn2

Ensembl ID:
ENSDARG00000063062
ZFIN ID:
ZDB-GENE-070112-612
Description:
ubinuclein 2 [Source:RefSeq peptide;Acc:NP_001073638]
Human Orthologue:
UBN2
Human Description:
ubinuclein 2 [Source:HGNC Symbol;Acc:21931]
Mouse Orthologue:
Ubn2
Mouse Description:
ubinuclein 2 Gene [Source:MGI Symbol;Acc:MGI:2444236]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20628 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091836 Nonsense 421 1153 6 16
Genomic Location (Zv9):
Chromosome 6 (position 7596083)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7522099
GRCz11 6 7679268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCCCAATGGACTTCCAGCACCTCTGATCAAGCGCATAGAGGACCTA[C/T]GAGCCGTGAGTCCTGTTTTTGTCACTTTTCAAATTCTCAATCCTATTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link