
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TULP4 (2 of 2)
- Ensembl ID:
- ENSDARG00000063056
- Description:
- tubby like protein 4 [Source:HGNC Symbol;Acc:15530]
- Human Orthologue:
- TULP4
- Human Description:
- tubby like protein 4 [Source:HGNC Symbol;Acc:15530]
- Mouse Orthologue:
- Tulp4
- Mouse Description:
- tubby like protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916092]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13784 | Nonsense | Available for shipment | Available now |
sa23000 | Nonsense | Available for shipment | Available now |
sa16367 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13784
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091818 | Nonsense | 457 | 1548 | 8 | 18 |
- Genomic Location (Zv9):
- Chromosome 17 (position 8039851)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 8042625 GRCz11 17 8199803 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGCGTTCAGAGGAAAACCCTGAGGCTGGAGGCCCCTGTTATACCCTCTA[T/A]CTGGAACAYCTCGGAGGTCTGGTGCCTATTCTCAAGGGCCGTCGCAKCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23000
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091818 | Nonsense | 773 | 1548 | 14 | 18 |
- Genomic Location (Zv9):
- Chromosome 17 (position 8042971)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 8045745 GRCz11 17 8202923 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTTCCTCCCCCTCCACATCATCTGCCACAACCACCCCACCAACAACGT[C/T]AGCAACCACAAGACCATCAACAGTCAAAGCATCAACAGCAATTACAACCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16367
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091818 | Nonsense | 1513 | 1548 | 18 | 18 |
- Genomic Location (Zv9):
- Chromosome 17 (position 8049358)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 8052132 GRCz11 17 8209310 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAATCAATTGCTTTTTCACCTAACCCATGATTCTCTATTACAGGTAATG[C/T]AGTTYGGCAGAATTGAYGGCAATGCATACATCCTGGACTTTCAGTAYCCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: