shank3b

Ensembl ID:
ENSDARG00000063054
ZFIN ID:
ZDB-GENE-041210-74
Description:
Novel protein similar to vertebrate SH3 and multiple ankyrin repeat domains family protein [Source:U
Human Orthologue:
SHANK3
Human Description:
SH3 and multiple ankyrin repeat domains 3 [Source:HGNC Symbol;Acc:14294]
Mouse Orthologue:
Shank3
Mouse Description:
SH3/ankyrin domain gene 3 Gene [Source:MGI Symbol;Acc:MGI:1930016]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45165 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018
sa2155 Nonsense Available for shipment Available now
sa33392 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33391 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091809 Essential Splice Site 344 1590 10 22
ENSDART00000145613 Splice Site None 1602 None 22
Genomic Location (Zv9):
Chromosome 4 (position 8627803)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9564651
GRCz11 4 9565567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCGTTTTTTATGTTGTGGTGTGCATAACTATGTCCCTGTCTTCCTAT[A/G]AAAGTGCCTTTCAGGGAGACCCCTTCTTATTCGTCCCGGCGGCGTGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091809 Nonsense 353 1590 10 22
ENSDART00000145613 Nonsense 368 1602 10 22
Genomic Location (Zv9):
Chromosome 4 (position 8627773)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9564621
GRCz11 4 9565537
KASP Assay ID:
554-2713.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGTCCCTGTCTTCCTATAAAAGTGCCTTTCAGGGAGACCCCTTCTTA[T/A]TCRTCCCGGCGGCGTGCGGTTTGTGTGTCTCCACGTCGCTCTCTGATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091809 Essential Splice Site 617 1590 16 22
ENSDART00000145613 Essential Splice Site 632 1602 16 22
Genomic Location (Zv9):
Chromosome 4 (position 8623477)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9560325
GRCz11 4 9561241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTTTCTACTTGTGTTGCATCTTTCTTTATCTCTCCCCACACCTCTC[A/T]GGTAAATGGTGTGAGCGTAGTAAAGGTGGGACATAGGCAGGTGGTATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091809 Nonsense 823 1590 21 22
ENSDART00000145613 Nonsense 835 1602 21 22
Genomic Location (Zv9):
Chromosome 4 (position 8620883)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9557731
GRCz11 4 9558647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATCCCACCCCCTCCACAGACAGCTCCCCCACCACCTCCGACTCCCTA[T/A]TTCCTTGATTCAGGGCCACCTCCATCCTTTCTTCCACCTCCGCCCCCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link