si:dkey-3n22.7

Ensembl ID:
ENSDARG00000063037
ZFIN ID:
ZDB-GENE-060503-734
Description:
Novel protein similar to vertebrate lipase, hormone-sensitive (LIPE) [Source:UniProtKB/TrEMBL;Acc:A3
Human Orthologue:
LIPE
Human Description:
lipase, hormone-sensitive [Source:HGNC Symbol;Acc:6621]
Mouse Orthologue:
Lipe
Mouse Description:
lipase, hormone sensitive Gene [Source:MGI Symbol;Acc:MGI:96790]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14644 Essential Splice Site Available for shipment Available now
sa43242 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091760 Essential Splice Site None 656 1 11
ENSDART00000142614 Essential Splice Site None 696 1 11
Genomic Location (Zv9):
Chromosome 19 (position 11416111)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10875340
GRCz11 19 10794265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGCATCTTACACGCGCGGCGGAGTTCAGTGAGTNNNNGACAGGTAAGCAAAG[G/A]TAAGCGCTCTTCAACAMTCCTCTCARCCTAAGCAAAAAGTTAGTTARAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091760 Essential Splice Site 167 656 5 11
ENSDART00000142614 Essential Splice Site 207 696 5 11
Genomic Location (Zv9):
Chromosome 19 (position 11439658)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10898887
GRCz11 19 10817812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCAGCTCCTTTAAAGATCTTTTATTACTGCGGTTTGCTCTTTTTTTC[A/G]GGCATCGCTGCTCTTTCTTTTTTTACATCGGGCAAATATGTGGTGGACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link