zgc:153063

Ensembl ID:
ENSDARG00000063009
ZFIN ID:
ZDB-GENE-060929-1170
Description:
Uncharacterized protein C2orf62 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08CH6]
Human Orthologue:
C2orf62
Human Description:
chromosome 2 open reading frame 62 [Source:HGNC Symbol;Acc:25062]
Mouse Orthologue:
Gm216
Mouse Description:
predicted gene 216 Gene [Source:MGI Symbol;Acc:MGI:2685062]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31504 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091700 Nonsense 109 356 5 10
Genomic Location (Zv9):
Chromosome 6 (position 12954163)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12807385
GRCz11 6 13042243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAATAACGAATGTAATACTACACATATATATTCCAATATTCCAGCTG[G/T]AAAAGAAAACGGTGGACCGGAAGATTCATATTGTTAGACAAGATGATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link