si:dkeyp-27e10.3

Ensembl ID:
ENSDARG00000063008
ZFIN ID:
ZDB-GENE-041210-96
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LVS7]
Human Orthologue:
KIAA1549
Human Description:
KIAA1549 [Source:HGNC Symbol;Acc:22219]
Mouse Orthologue:
D630045J12Rik
Mouse Description:
RIKEN cDNA D630045J12 gene Gene [Source:MGI Symbol;Acc:MGI:2669829]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20213 Essential Splice Site Available for shipment Available now
sa20212 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091694 Essential Splice Site 315 748 5 14
ENSDART00000146858 Essential Splice Site 1044 1447 14 20
Genomic Location (Zv9):
Chromosome 4 (position 8854322)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9791170
GRCz11 4 9792086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCAATCTGACAGACAAGATTACTGACGGAGCAAAGGTCAACAGTGAGG[T/C]TAGCAAACATTCATGTTTACCTTCCGGGATGTGCCTTTTTAAAGAGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091694 Nonsense 365 748 6 14
ENSDART00000146858 Nonsense 1094 1447 15 20
Genomic Location (Zv9):
Chromosome 4 (position 8853914)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9790762
GRCz11 4 9791678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGACATCATGGCAGCGTTCGGCGACAACTCCGAGCAGCAGCGAGTGTA[T/G]CAACAAGCTCAGGAGCAGATACACAAGATCTTGCATCCTGACGAGCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link