zgc:154074

Ensembl ID:
ENSDARG00000063001
ZFIN IDs:
ZDB-GENE-060929-36, ZDB-GENE-060929-36
Description:
hypothetical protein LOC767630 [Source:RefSeq peptide;Acc:NP_001070040]
Human Orthologue:
ATP8A1
Human Description:
ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 [Source:HGNC Symbol;Acc:135
Mouse Orthologue:
Atp8a1
Mouse Description:
ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42445 Nonsense Mutation detected in F1 DNA During 2018
sa35751 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091620 Nonsense 62 293 2 10
ENSDART00000091625 Nonsense 62 326 2 9
Genomic Location (Zv9):
Chromosome 14 (position 47903700)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 45988734
GRCz11 14 44937839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAACGCTGGTGCCATTACTTTTCATCCTGGTGGTTGCGGCAGTGAAG[G/T]AGATTATTGAAGATCTGGTGAGAGAAATCTAAGATTTGTGATGTTACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091620 Nonsense 132 293 6 10
ENSDART00000091625 Nonsense 132 326 6 9
Genomic Location (Zv9):
Chromosome 14 (position 47921657)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 46006691
GRCz11 14 44955796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGCTGTTTATTTTAGTGAACCTCAAGGAATGTGCTACATTGAGACTT[C/A]AAATCTGGACGGAGAAACCAATCTCAAGATCAGACAGGTGAGTTTTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link