zgc:153368

Ensembl ID:
ENSDARG00000062987
ZFIN ID:
ZDB-GENE-060929-688
Description:
tRNA wybutosine-synthesizing protein 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08C92]
Human Orthologue:
TYW1
Human Description:
tRNA-yW synthesizing protein 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25598]
Mouse Orthologue:
Tyw1
Mouse Description:
tRNA-yW synthesizing protein 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2141161]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35843 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14926 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091640 Essential Splice Site 2 730 1 16
ENSDART00000142870 Essential Splice Site 26 754 1 16
Genomic Location (Zv9):
Chromosome 15 (position 15891439)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16936402
GRCz11 15 16872424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGGTGTTGTCGGGTTTGGTGTGTTCTGCAGTCGGCGCTGAGATGTCAG[G/A]TAACGTTAGGTTTTTATTTTGCTAAGCGTGGCTGATAACAGCATACAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091640 Nonsense 526 730 13 16
ENSDART00000142870 Nonsense 550 754 13 16
Genomic Location (Zv9):
Chromosome 15 (position 15813150)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16858113
GRCz11 15 16794135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTTTTTNNNCAACTTTTTTTCTTTTTTATAGGAGTCTCGTGCCTGTTACT[C/T]AACTTTATGTCAGCGTTGATGCCAGCACCAAGGACAGTCTGAAGAAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link