zgc:158748

Ensembl ID:
ENSDARG00000062986
ZFIN ID:
ZDB-GENE-070112-1812
Description:
hypothetical protein LOC791173 [Source:RefSeq peptide;Acc:NP_001074124]
Human Orthologue:
PNPLA7
Human Description:
patatin-like phospholipase domain containing 7 [Source:HGNC Symbol;Acc:24768]
Mouse Orthologue:
Pnpla7
Mouse Description:
patatin-like phospholipase domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2385325]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17879 Nonsense Available for shipment Available now
sa12736 Nonsense Available for shipment Available now
sa15605 Nonsense Available for shipment Available now
sa17327 Nonsense Available for shipment Available now
sa23884 Nonsense Available for shipment Available now
sa13939 Nonsense Available for shipment Available now
sa11634 Nonsense Available for shipment Available now
sa37254 Essential Splice Site Available for shipment Available now
sa463 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023504 Nonsense 83 1354 4 35
ENSDART00000091647 Nonsense 83 328 5 10
ENSDART00000142983 Nonsense 83 329 5 12
Genomic Location (Zv9):
Chromosome 21 (position 11859591)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13560765
GRCz11 21 13657494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGGGTTCCTCGCTATCGCTTCAGAAAAAGAGATAAAGTGCTCTTTTA[C/A]GGCAGGAAAATCATGAGAAAGGTGAGTCCATTCTCACTTAATTCTATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023504 Nonsense 472 1354 14 35
ENSDART00000091647   None 328 None 10
ENSDART00000142983   None 329 None 12
Genomic Location (Zv9):
Chromosome 21 (position 11844739)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13545913
GRCz11 21 13642642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCATTTTYCAAGCCGCCAAGAAGGATCTACTAGGGATTATTCCACTG[C/T]AGGTTAAAATTTGTGAGATATGGGCTCATGGTTTATGTATGTTCAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023504 Nonsense 472 1354 14 35
ENSDART00000091647   None 328 None 10
ENSDART00000142983   None 329 None 12
Genomic Location (Zv9):
Chromosome 21 (position 11844739)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13545913
GRCz11 21 13642642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCATTTTYCAAGCCGCCAAGAAGGATCTACTAGGGATTATTCCACTG[C/T]AGGTTAAAATTTGTGAGATATGGGCTCATGGTTTATGTATGTTCAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023504 Nonsense 519 1354 16 35
ENSDART00000091647   None 328 None 10
ENSDART00000142983   None 329 None 12
Genomic Location (Zv9):
Chromosome 21 (position 11843886)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13545060
GRCz11 21 13641789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGTTTGTGATCTCGGGCACGTTGCATGTATACCAGCGGATGATTGAC[C/T]GAGAGGAGGACACATGTCTGTTCGTGGCTCACCCAGGAGAGCTGGTGGGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023504 Nonsense 775 1354 22 35
ENSDART00000091647   None 328 None 10
ENSDART00000142983   None 329 None 12
Genomic Location (Zv9):
Chromosome 21 (position 11830745)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13531919
GRCz11 21 13628648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCATGTCTTCCAGGTCCCACTCTTCTTTTAAATAGTGACATCATCAAA[C/T]AACGCCTTGGTTCTGCTGCTTTAGACAGGTAGGAAACAAAGCGTCATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023504 Nonsense 822 1354 23 35
ENSDART00000091647   None 328 None 10
ENSDART00000142983   None 329 None 12
Genomic Location (Zv9):
Chromosome 21 (position 11828468)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13529642
GRCz11 21 13626371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATCAGACAGATGTGTCACTCACCCCGTGGACTCAGCGCTGCAYCAGA[C/T]AGGCTGATTGCATCATCATCGTGGGACTAGGAGAGCAGGACCCAGCCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023504 Nonsense 859 1354 24 35
ENSDART00000091647   None 328 None 10
ENSDART00000142983   None 329 None 12
Genomic Location (Zv9):
Chromosome 21 (position 11827531)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13528705
GRCz11 21 13625434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCATGTTAGAGGGGAGTGCRGTGAGAGYGCAGAAACAGCTGGTGTTGT[T/A]GCACYGTGAGGACGGTCCTCCTCCCAAAGGAACTGCTGAATGGCTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023504 Essential Splice Site 901 1354 24 35
ENSDART00000091647   None 328 None 10
ENSDART00000142983   None 329 None 12
Genomic Location (Zv9):
Chromosome 21 (position 11827402)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13528576
GRCz11 21 13625305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTCCTGCCCCCGCAGAGTCTTCTCCAAGAGGAGCCTGCCAAAATTGG[T/G]ACAGCACTCAATATTACATTACAGATTTAGTAAAATAATGACAACATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023504 Nonsense 1199 1354 32 35
ENSDART00000091647   None 328 None 10
ENSDART00000142983   None 329 None 12
Genomic Location (Zv9):
Chromosome 21 (position 11817329)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13518503
GRCz11 21 13615232
KASP Assay ID:
554-0168.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTATTTTATCAATCAATTGATTCTGTGCATGTATAGGAAGTTGGATA[C/A]CAGCATGGGAAGACAGTGTTCGATGTGTGGTGCAGAAGTGGAGTGGTGGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link