si:dkey-22l11.2

Ensembl ID:
ENSDARG00000062983
ZFIN ID:
ZDB-GENE-041210-99
Description:
F-box only protein 18 [Source:RefSeq peptide;Acc:NP_001038614]
Human Orthologue:
FBXO18
Human Description:
F-box protein, helicase, 18 [Source:HGNC Symbol;Acc:13620]
Mouse Orthologue:
Fbxo18
Mouse Description:
F-box protein 18 Gene [Source:MGI Symbol;Acc:MGI:1354699]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33396 Nonsense Mutation detected in F1 DNA During 2018
sa9000 Nonsense Mutation detected in F1 DNA During 2018
sa40228 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091630 Nonsense 532 1011 10 22
ENSDART00000133169 Nonsense 536 992 9 20
Genomic Location (Zv9):
Chromosome 4 (position 8922277)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9859125
GRCz11 4 9860041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCGTCCACAGACCAGCGTGTCGACACGCAACACGTCCCGTTCGAGTA[C/A]AAGAATACAAAAGGCTTAAGGGAACAGCCAGATGAAGAGGCCAAAAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091630 Nonsense 617 1011 13 22
ENSDART00000133169 Nonsense 621 992 12 20
Genomic Location (Zv9):
Chromosome 4 (position 8920905)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9857753
GRCz11 4 9858669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTTATTATTTCATCAGTCATCATGGACATCATGCTCTCCCAGCGCTG[T/A]GGGAAAATCCTGGTWGGAGATCCTCATCAGCAGATCTACACTTTYAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091630 Nonsense 912 1011 20 22
ENSDART00000133169 Nonsense 894 992 19 20
Genomic Location (Zv9):
Chromosome 4 (position 8917557)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9854405
GRCz11 4 9855321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATCCATATGTGATGACACTGAAGCATATTTGTCTGTCACAGGAGTA[T/A]TTCCTGAGATCAGAGCAGACCAGCTCTCTGCTGAGTAAAGATCCAGCGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link