si:dkey-27b3.9

Ensembl ID:
ENSDARG00000062974
ZFIN ID:
ZDB-GENE-091118-70
Human Orthologue:
ITGA2
Human Description:
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) [Source:HGNC Symbol;Acc:6137]
Mouse Orthologue:
Itga2
Mouse Description:
integrin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:96600]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41597 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8762 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa16899 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091597 Essential Splice Site 145 1167 4 28
ENSDART00000139466 Essential Splice Site 107 806 3 17
Genomic Location (Zv9):
Chromosome 10 (position 9003207)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9079163
GRCz11 10 8912722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAGCCCACAGTTTACCCTCCAGTCGGCTTTTTCCCCTGCTGTTCAAA[G/T]TACTAACACACATCTGTATCCTCTCTCTGAAAGTTTACTCTTCAGGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091597 Splice Site, Nonsense 581 1167 13 28
ENSDART00000139466 Splice Site, Nonsense 541 806 12 17
Genomic Location (Zv9):
Chromosome 10 (position 9012828)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9088784
GRCz11 10 8922343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTTACATCTACTATGGYCACAGAAAAAGCATAAAAAAGCAGAGCTCA[C/T]AGGTAAAATGACACACTTGACAAACTCCTTAACACGCATTAAATATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091597 Nonsense 1109 1167 27 28
ENSDART00000139466   None 806 None 17
Genomic Location (Zv9):
Chromosome 10 (position 9030631)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9106587
GRCz11 10 8940146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATAGCWATCATTGCCATCATACATGACAGGTTGAMGTCAAAGTTAGC[A/T]AACCTGGAGCTAAAGCAGAYGTTCCAGTGGGTGCCATTGTGGGAAGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link