ttll7

Ensembl ID:
ENSDARG00000062973
ZFIN ID:
ZDB-GENE-070112-2112
Description:
tubulin polyglutamylase TTLL7 [Source:RefSeq peptide;Acc:NP_001074064]
Human Orthologue:
TTLL7
Human Description:
tubulin tyrosine ligase-like family, member 7 [Source:HGNC Symbol;Acc:26242]
Mouse Orthologue:
Ttll7
Mouse Description:
tubulin tyrosine ligase-like family, member 7 Gene [Source:MGI Symbol;Acc:MGI:1918142]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38825 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35024 Nonsense Mutation detected in F1 DNA During 2018
sa41784 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091617 Essential Splice Site 457 505 None 13
ENSDART00000101561 Essential Splice Site 457 917 None 20
Genomic Location (Zv9):
Chromosome 11 (position 8192963)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8037066
GRCz11 11 8046905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAATCAGATAAAACCCTTTTTTCTCCTCTCTCTCTTTCTCTCCATAC[A/T]GACGTATTTACCCCCCAGATGACAAGCTGCTCTTGGAGAAATATGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091617   None 505 None 13
ENSDART00000101561 Nonsense 605 917 15 20
Genomic Location (Zv9):
Chromosome 11 (position 8158603)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8002706
GRCz11 11 8012545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGGAAACCTGCCCCTAAACCAGTGCGGGGTCCTTCCTCCTCACCCTA[T/A]CTTTCTGGATTCATCCGCCGCTCTATGTCCTGTCCCCGCTCCATATCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091617   None 505 None 13
ENSDART00000101561 Nonsense 806 917 18 20
Genomic Location (Zv9):
Chromosome 11 (position 8147213)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7991316
GRCz11 11 8001155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTACGTCTGTATCGCCTCTTCAATCGTGTGTTTAACCGTCTGCTCTG[G/A]AGCCATGGTCAGGGGCTCTGGAACTGCCTCTCCACCTCTGGGTAAGAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link