si:dkey-246g23.3

Ensembl ID:
ENSDARG00000062967
ZFIN ID:
ZDB-GENE-050419-11
Description:
hypothetical protein LOC561003 [Source:RefSeq peptide;Acc:NP_001103499]
Human Orthologue:
KCNG4
Human Description:
potassium voltage-gated channel, subfamily G, member 4 [Source:HGNC Symbol;Acc:19697]
Mouse Orthologue:
Kcng4
Mouse Description:
potassium voltage-gated channel, subfamily G, member 4 Gene [Source:MGI Symbol;Acc:MGI:1913983]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30703 Nonsense Mutation detected in F1 DNA During 2018
sa23254 Nonsense Available for shipment Available now
sa1884 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091610 Nonsense 48 538 1 2
ENSDART00000146472 Nonsense 48 538 2 3
Genomic Location (Zv9):
Chromosome 18 (position 14066136)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14511554
GRCz11 18 14480066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCGAGACCATCAAGGGAGTGTATTACCAGCGGGCTCAGTTTATTCGC[C/T]GACCCGAAGACCTTAATTTGGTTGATCATGGCCTGCAGGCTCTCATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091610 Nonsense 345 538 2 2
ENSDART00000146472 Nonsense 345 538 3 3
Genomic Location (Zv9):
Chromosome 18 (position 14115633)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14561051
GRCz11 18 14529563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAGCTTGGATTGGTACTACGGATCCTACGTGCCCTTCGGATCCTCTA[T/A]GTGATGCGGCTGGCCCGCCACTCTCTGGGTTTGCAGACACTGGGACTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091610 Nonsense 409 538 2 2
ENSDART00000146472 Nonsense 409 538 3 3
Genomic Location (Zv9):
Chromosome 18 (position 14115825)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14561243
GRCz11 18 14529755
KASP Assay ID:
554-1874.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGAGCTGACCGGAGYGCAGGATTTCAGCAGCATCCCTGCTTCTTATTG[G/A]TGGGCGATCATCTCCATGACCACAGTGGGTTATGGAGACATGGTGCCYAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link