sult4a1

Ensembl ID:
ENSDARG00000062957
ZFIN ID:
ZDB-GENE-060421-2705
Description:
sulfotransferase 4A1 [Source:RefSeq peptide;Acc:NP_001035334]
Human Orthologue:
SULT4A1
Human Description:
sulfotransferase family 4A, member 1 [Source:HGNC Symbol;Acc:14903]
Mouse Orthologue:
Sult4a1
Mouse Description:
sulfotransferase family 4A, member 1 Gene [Source:MGI Symbol;Acc:MGI:1888971]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24750 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091573 Essential Splice Site 127 284 3 7
Genomic Location (Zv9):
Chromosome Zv9_scaffold3512 (position 22815)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 8802204
GRCz11 4 8803120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCCGTACCGTTTTCTGCCATCAGCCATGCACAATGGAGAAGGCAAGG[T/A]CAGCTGTAAAACACAATGAAAACAAATGAATCATAATTGAATATCTGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link