wasf3

Ensembl ID:
ENSDARG00000062948
ZFIN ID:
ZDB-GENE-070112-1512
Description:
wiskott-Aldrich syndrome protein family member 3 [Source:RefSeq peptide;Acc:NP_001074059]
Human Orthologue:
WASF3
Human Description:
WAS protein family, member 3 [Source:HGNC Symbol;Acc:12734]
Mouse Orthologue:
Wasf3
Mouse Description:
WAS protein family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2658986]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24495 Essential Splice Site Available for shipment Available now
sa44132 Nonsense Mutation detected in F1 DNA During 2018
sa37881 Nonsense Mutation detected in F1 DNA During 2018
sa44133 Nonsense Mutation detected in F1 DNA During 2018
sa14506 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091529 Essential Splice Site None 481 1 9
Genomic Location (Zv9):
Chromosome 24 (position 22148934)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21395812
GRCz11 24 21540986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCCTGGACATGTGAGCGAATACAATTCTCTACAAATTTCACTTTTGG[T/A]AAGTCTTCAACGTGCACTAACCTCCCCTAATGTACTTATTTGTTTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091529 Nonsense 88 481 3 9
Genomic Location (Zv9):
Chromosome 24 (position 22169053)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21415931
GRCz11 24 21561105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCATTGACCGTCTCGCCGTCAAGGTCACCCAGCTGGACTCCACCGTC[G/T]AGGAGGGTGAGTGTTTGTGCTTCTGTGAAACAAGAGCTGCGTCGCTCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091529 Nonsense 107 481 4 9
Genomic Location (Zv9):
Chromosome 24 (position 22171466)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21418344
GRCz11 24 21563518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTGCAGGACATAAACATGAGGAAGGCGTTTAAGAGCTCTACTATA[C/T]AGGACCAGCAGGTGGTGTCCAAGAGCAGTGTTCCCATTCCTGTGACCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091529 Nonsense 221 481 6 9
Genomic Location (Zv9):
Chromosome 24 (position 22176814)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21423692
GRCz11 24 21568866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGGAGTGGAACATGATGGCCTTCGATAAGGAACTGAGACCTGACCTT[C/T]GACATTCACACACTGTACACAGAGGAGGATCCACAGAGGGCACCATGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091529 Nonsense 293 481 7 9
Genomic Location (Zv9):
Chromosome 24 (position 22180594)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21427472
GRCz11 24 21572646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATACTCAKATGAGCCTGGATCAGGATTACCGCAGCGGGTCAATGGCGTA[T/A]CGTWCTGGGACTCTCGGTCGCCCACATCAGGCTCCACCTCCTCCACCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link