
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
im:7155895
- Ensembl ID:
- ENSDARG00000062947
- ZFIN ID:
- ZDB-GENE-060810-59
- Description:
- Im:7155895 protein [Source:UniProtKB/TrEMBL;Acc:Q08C15]
- Human Orthologue:
- AMN
- Human Description:
- amnionless homolog (mouse) [Source:HGNC Symbol;Acc:14604]
- Mouse Orthologue:
- Amn
- Mouse Description:
- amnionless Gene [Source:MGI Symbol;Acc:MGI:1934943]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6923 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6923
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091556 | Nonsense | 62 | 478 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 3 (position 57610560)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 56808944 GRCz11 3 56876470 - KASP Assay ID:
- 554-5106.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCGGGAATGACCAAGTGGAGTTTTTAGCAAAYAGGAAAGTGTCGGTGTA[T/A]GTAGAAACAGCTCACACTATTACCGGGATGAGCTTGCCTGTRGATGGAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: