
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
idua
- Ensembl ID:
- ENSDARG00000062904
- ZFIN ID:
- ZDB-GENE-060526-29
- Description:
- Novel protein similar to vertebrate iduronidase, alpha-L-(IDUA) [Source:UniProtKB/TrEMBL;Acc:A2ARH2]
- Human Orthologue:
- IDUA
- Human Description:
- iduronidase, alpha-L- [Source:HGNC Symbol;Acc:5391]
- Mouse Orthologue:
- Idua
- Mouse Description:
- iduronidase, alpha-L- Gene [Source:MGI Symbol;Acc:MGI:96418]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38450 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14162 | Nonsense | Available for shipment | Available now |
sa40364 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38450
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091463 | Nonsense | 72 | 637 | 2 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 9442974)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 8544846 GRCz11 5 9049484 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCCGCAGCCGCACACGGATGCACACCTGTATGATCTCAGTCCAGACCAG[C/T]AGATGAATCTGGCCTTGATCGGCTCAGTGCCACACAGAGGAATCCAGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14162
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091463 | Nonsense | 175 | 637 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 9447863)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 8549735 GRCz11 5 9054373 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTGTTGTKWTTGTAAACAGGGAAATACGGCCTGGGCTTTGTTTCTCAGT[G/A]GAACTTTGAGACKTGGAATGAACCGAACAATCATGATTTTGACAACATCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40364
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091463 | Nonsense | 201 | 637 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 9450191)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 8552063 GRCz11 5 9056701 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGGCTTCATTGTCAGGATTATTTTTTCCGGCTCCAGGGTTTCTGAACTA[T/G]TATGATGCGTGTTCTGAGGGCCTTCGTGCAGCGAGTCCTTTGTTGAAATT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: