zgc:162199

Ensembl ID:
ENSDARG00000062898
ZFIN ID:
ZDB-GENE-070410-34
Description:
hypothetical protein LOC100037385 [Source:RefSeq peptide;Acc:NP_001083005]
Human Orthologue:
C14orf145
Human Description:
chromosome 14 open reading frame 145 [Source:HGNC Symbol;Acc:20359]
Mouse Orthologue:
4930534B04Rik
Mouse Description:
RIKEN cDNA 4930534B04 gene Gene [Source:MGI Symbol;Acc:MGI:1922466]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43380 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091449 Nonsense 942 969 22 22
Genomic Location (Zv9):
Chromosome 20 (position 6009262)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5932871
GRCz11 20 5977139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCCTACAATTACATACTGTTTTTCTTCTCACTTTTGTTGTAATCAGCA[C/T]AGAAACCTGTTGCCAATCCAGATTTGGAACCCAGTCTGACCCAAGAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link