
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
eea1
- Ensembl ID:
- ENSDARG00000062868
- ZFIN IDs:
- ZDB-GENE-041008-68, ZDB-GENE-041111-270
- Description:
- Novel protein similar to H.sapiens EEA1, early endosome antigen 1 (EEA1) [Source:UniProtKB/TrEMBL;Ac
- Human Orthologue:
- EEA1
- Human Description:
- early endosome antigen 1 [Source:HGNC Symbol;Acc:3185]
- Mouse Orthologue:
- Eea1
- Mouse Description:
- early endosome antigen 1 Gene [Source:MGI Symbol;Acc:MGI:2442192]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa29005 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36607 | Nonsense | Available for shipment | Available now |
sa44886 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa29005
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091349 | Nonsense | 242 | 1398 | 9 | 30 |
ENSDART00000141800 | Nonsense | 242 | 811 | 9 | 19 |
ENSDART00000142527 | None | 255 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 15531445)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 15883857 GRCz11 18 15852369 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACATGACCCGAGAGCGAGAGGAGGAGTCAGAGCGCCTCAAAGGCCAATA[T/G]GAGCAGCTGCAGGCCAACTTCACTACCTCAGAGGTACAGATGGCTAAATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36607
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091349 | Nonsense | 395 | 1398 | 11 | 30 |
ENSDART00000141800 | Nonsense | 395 | 811 | 11 | 19 |
ENSDART00000142527 | None | 255 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 15542653)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 15895065 GRCz11 18 15863577 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAGGCAGAGCGGAAACAACTTCAACAGCAGAGGGAGGATAAAGAAAAC[C/T]AGGGCCTGCAGCAACAGAGTGAGATCAGCCAGGTCAGTAAGAGATGCTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44886
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091349 | Essential Splice Site | 1143 | 1398 | 24 | 30 |
ENSDART00000141800 | None | 811 | None | 19 | |
ENSDART00000142527 | None | 255 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 18 (position 15554276)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 15906688 GRCz11 18 15875200 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAACAAACTGTCTGCTGATCTCAAAACACTGGCTGAGAAGAATGAGAAG[G/A]TTAGACCCCAAAACACATTGAAATTCACATTAACAATCATGTAATGTGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: