si:rp71-86k19.1

Ensembl ID:
ENSDARG00000062854
ZFIN IDs:
ZDB-GENE-080204-97, ZDB-GENE-080204-97, ZDB-GENE-090311-17
Description:
Zgc:171522 protein [Source:UniProtKB/TrEMBL;Acc:A9JR85]
Human Orthologue:
SDK1
Human Description:
sidekick homolog 1, cell adhesion molecule (chicken) [Source:HGNC Symbol;Acc:19307]
Mouse Orthologue:
Sdk1
Mouse Description:
sidekick homolog 1 (chicken) Gene [Source:MGI Symbol;Acc:MGI:2444413]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39561 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9553 Essential Splice Site, Missense Available for shipment Available now
sa11498 Essential Splice Site, Missense Available for shipment Available now
sa19443 Essential Splice Site Available for shipment Available now
sa9945 Nonsense Available for shipment Available now
sa5935 Nonsense Mutation detected in F1 DNA During 2018
sa24835 Nonsense Mutation detected in F1 DNA During 2018
sa11705 Nonsense Available for shipment Available now
sa38249 Nonsense Mutation detected in F1 DNA During 2018
sa39560 Nonsense Mutation detected in F1 DNA During 2018
sa17607 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Essential Splice Site 89 2120 2 46
ENSDART00000141238 Essential Splice Site 90 2095 2 44
ENSDART00000144164 Essential Splice Site 89 199 2 4
Genomic Location (Zv9):
Chromosome 1 (position 10549841)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10682179
GRCz11 1 11366290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGGATGGGAGCGCTGATCCAGACGAGAGCCGATGTTCGTGTGGCTTG[T/C]AAGTACACGTGTATGATGTTAGAAAGGGAGTTCGGGAGGCTGAAGCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Essential Splice Site 183 2120 None 46
ENSDART00000141238 Essential Splice Site 184 2095 None 44
ENSDART00000144164 Missense 183 199 4 4
ENSDART00000091205 Essential Splice Site 183 2120 None 46
ENSDART00000141238 Essential Splice Site 184 2095 None 44
ENSDART00000144164 Missense 183 199 4 4
Genomic Location (Zv9):
Chromosome 1 (position 10523972)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10656310
GRCz11 1 11340421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTAATGGGGAAAACAAAACCAGTCCTTCCATTTACCTGAGCATAGCAAG[T/A]AAGTTGTTTTGTCATTYATACTGTTTTGCTGTATTATTTAAATATATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Essential Splice Site 183 2120 None 46
ENSDART00000141238 Essential Splice Site 184 2095 None 44
ENSDART00000144164 Missense 183 199 4 4
ENSDART00000091205 Essential Splice Site 183 2120 None 46
ENSDART00000141238 Essential Splice Site 184 2095 None 44
ENSDART00000144164 Missense 183 199 4 4
Genomic Location (Zv9):
Chromosome 1 (position 10523972)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10656310
GRCz11 1 11340421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTAATGGGGAAAACAAAACCAGTCCTTCCATTTACCTGAGCATAGCAAG[T/A]AAGTTGTTTTGTCATTYATACTGTTTTGCTGTATTATTTAAATATATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Essential Splice Site 810 2120 18 46
ENSDART00000141238 Essential Splice Site 809 2095 18 44
ENSDART00000144164   None 199 None 4
Genomic Location (Zv9):
Chromosome 1 (position 10414142)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10546480
GRCz11 1 11230591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTAAAAACATTTTGTGTTGGTCTTATTGTTCTTTGGCATCTTTTTAC[A/C]GCTGCTGGTGTGGCCTGAACACTGTCCGGATTGCATTACAATGGTGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Nonsense 913 2120 20 46
ENSDART00000141238 Nonsense 910 2095 20 44
ENSDART00000144164   None 199 None 4
Genomic Location (Zv9):
Chromosome 1 (position 10401000)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10533338
GRCz11 1 11217449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATATCCCCTTTTCTMATTTTCGCCTCTCCATAGGTTACGTCTTGAGCT[G/A]GCAGGAGGCTGGTCAGAAYGAAACGCTCGTATCTCAGACTCTGTCCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Nonsense 1029 2120 22 46
ENSDART00000141238 Nonsense 1026 2095 22 44
ENSDART00000144164   None 199 None 4
Genomic Location (Zv9):
Chromosome 1 (position 10390815)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10523153
GRCz11 1 11207264
KASP Assay ID:
554-3791.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGAYTGTGGGTGAGGAGGAAAAGGAGGCAGAATGGAAGGTTTTATA[T/G]GAGAGAGACAGTCCTCMAGCCTCAGACACACTGGAGATTCCCAATCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Nonsense 1054 2120 23 46
ENSDART00000141238 Nonsense 1051 2095 23 44
ENSDART00000144164   None 199 None 4
Genomic Location (Zv9):
Chromosome 1 (position 10390260)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10522598
GRCz11 1 11206709
KASP Assay ID:
554-7602.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTGTTTTCGTTCTCGTTCTCTCCTCTTTTATATGGCTTCTAGGTTC[A/T]GAATGAAGCAGGTGAACATTGTTGGTTCGAGCCCCTTTAGTGAGTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Nonsense 1094 2120 23 46
ENSDART00000141238 Nonsense 1091 2095 23 44
ENSDART00000144164   None 199 None 4
Genomic Location (Zv9):
Chromosome 1 (position 10390140)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10522478
GRCz11 1 11206589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCCAGTCCAGATGTGGCCCCGACTGAGCTTGTCGTGTTTWCAGCCAGT[G/T]AAACCAGCCTGAGGATTCGCTGGGAGGTTAGAAAGACATACACACACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Nonsense 1299 2120 28 46
ENSDART00000141238 Nonsense 1303 2095 27 44
ENSDART00000144164   None 199 None 4
Genomic Location (Zv9):
Chromosome 1 (position 10364248)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10496586
GRCz11 1 11180697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGCTGATGTTTCCAGAAGTGCGTCTCTCGTCTGTCAGGGTCGTCTGG[C/T]AACCTCCGTCTGAGCCCAACGGCATCATTATGGGTACCAGAAAAATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Nonsense 1312 2120 29 46
ENSDART00000141238 Nonsense 1316 2095 28 44
ENSDART00000144164   None 199 None 4
Genomic Location (Zv9):
Chromosome 1 (position 10353659)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10485997
GRCz11 1 11170108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAAAACAATGCACTCCAGCTGTTTTGACTTTTGTTTCTGCAGGTTAT[C/T]AGATTTCTTACCGTCTTGATATCAACGACCCCAACAAGTTCACCACGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091205 Essential Splice Site 1988 2120 44 46
ENSDART00000141238 Essential Splice Site 1963 2095 42 44
ENSDART00000144164   None 199 None 4
Genomic Location (Zv9):
Chromosome 1 (position 10311973)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10444311
GRCz11 1 11128422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGACATCTGAACGTGAAGAGCTCTTTCCTCAAGAAGAATGGAACAAG[G/A]TAAGGCTTCATTGAACTGCGGTTAAAGCGTTTTGATGCTCTTTACACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link