si:dkey-33c18.3

Ensembl ID:
ENSDARG00000062837
ZFIN ID:
ZDB-GENE-091116-25
Human Orthologue:
SPATA13
Human Description:
spermatogenesis associated 13 [Source:HGNC Symbol;Acc:23222]
Mouse Orthologue:
Spata13
Mouse Description:
spermatogenesis associated 13 Gene [Source:MGI Symbol;Acc:MGI:104838]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37887 Nonsense Mutation detected in F1 DNA During 2018
sa13727 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091252 Nonsense 337 1251 2 14
Genomic Location (Zv9):
Chromosome 24 (position 22496243)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21743121
GRCz11 24 21888295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATTTGCAAAAGCTTGTCGGTAGTTTAACTGACCTCACAGTCAAGCGC[A/T]AAAACATTGCAAGCCCTTCTCCAAGAGTGCCAGTGTCACCCCTTAGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091252 Essential Splice Site 700 1251 5 14
Genomic Location (Zv9):
Chromosome 24 (position 22487201)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21734079
GRCz11 24 21879253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGCCTGGATCGGATGGGGCGTCGCAAAGGGCGCAGAGTGCTCAGTGG[T/C]GAGTGTGATTTTTATTTATAAACATGAACATGTARTTGACTTGCAAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link