si:dkeyp-86f7.6

Ensembl ID:
ENSDARG00000062830
ZFIN ID:
ZDB-GENE-091118-44
Human Orthologue:
FAM46D
Human Description:
family with sequence similarity 46, member D [Source:HGNC Symbol;Acc:28399]
Mouse Orthologue:
Fam46d
Mouse Description:
family with sequence similarity 46, member D Gene [Source:MGI Symbol;Acc:MGI:2685223]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44801 Nonsense Mutation detected in F1 DNA During 2018
sa22428 Nonsense Available for shipment Available now
sa28265 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091250 Nonsense 87 392 1 4
ENSDART00000138535 Nonsense 81 393 2 3
Genomic Location (Zv9):
Chromosome 14 (position 9518826)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9040666
GRCz11 14 9346680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGCTCTACAGCCAGCCATGTGCTGGTTAAAGAAAACGGCACCAGCTA[T/G]AAAGACCTGGATATCATCTTTGGTGTTGAGCTTCCCAAGCCAGAGGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091250 Nonsense 174 392 1 4
ENSDART00000138535 Nonsense 168 393 2 3
Genomic Location (Zv9):
Chromosome 14 (position 9518567)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9040407
GRCz11 14 9346421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACAATAGTGGTAAGAATGTAGAGCTCAAGTTTGTCAACTCTCTACGA[C/T]GACAGTTTGAATTCAGCGTGGACTCCTTTCAGATCATCCTGGACAGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091250 Nonsense 267 392 4 4
ENSDART00000138535 Nonsense 264 393 3 3
Genomic Location (Zv9):
Chromosome 14 (position 9516398)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9038238
GRCz11 14 9344252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTGTCCGGGATTTCAAACCAGCCTGCGAAACTGAAATTAAGACACTC[G/T]AGCGCTATATGTGTTCACGTTTTTTTATTGACTTCCCTGACGTGAACGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link