zgc:158843

Ensembl ID:
ENSDARG00000062817
ZFIN IDs:
ZDB-GENE-070112-1782, ZDB-GENE-070112-1782
Description:
mu-crystallin homolog [Source:RefSeq peptide;Acc:NP_001074156]
Human Orthologue:
CRYM
Human Description:
crystallin, mu [Source:HGNC Symbol;Acc:2418]
Mouse Orthologue:
Crym
Mouse Description:
crystallin, mu Gene [Source:MGI Symbol;Acc:MGI:102675]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24903 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41973 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091229 Essential Splice Site 106 312 3 9
ENSDART00000111422 Essential Splice Site 105 311 3 9
Genomic Location (Zv9):
Chromosome 12 (position 11527760)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10410831
GRCz11 12 10448674
KASP Assay ID:
554-7470.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGCCACCGTCTTACTTTTTCACCCCGAGCGAGGACACATCACTGCGG[T/G]GAGACACACAAACCACATCTGTCTGTCTCACTTAATTTAATTGTTATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091229 Essential Splice Site 161 312 5 9
ENSDART00000111422 Essential Splice Site 160 311 5 9
Genomic Location (Zv9):
Chromosome 12 (position 11530570)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10413641
GRCz11 12 10451484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTAAAAGCCATTATGATGTCTTTACAAACGTCTTCAAGTTTAAAGAG[G/A]TAACTAGTCTGATCATGAGATATACAGATTTGAATGATTTTTAATTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link