whsc1l1

Ensembl ID:
ENSDARG00000062765
ZFIN ID:
ZDB-GENE-050324-2
Description:
Wolf-Hirschhorn syndrome candidate 1-like 1 [Source:UniProtKB/TrEMBL;Acc:A5XBQ2]
Human Orthologue:
WHSC1L1
Human Description:
Wolf-Hirschhorn syndrome candidate 1-like 1 [Source:HGNC Symbol;Acc:12767]
Mouse Orthologue:
Whsc1l1
Mouse Description:
Wolf-Hirschhorn syndrome candidate 1-like 1 (human) Gene [Source:MGI Symbol;Acc:MGI:2142581]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41640 Nonsense Mutation detected in F1 DNA During 2018
sa14276 Nonsense Available for shipment Available now
sa34885 Nonsense Mutation detected in F1 DNA During 2018
sa41639 Nonsense Mutation detected in F1 DNA During 2018
sa16134 Nonsense Available for shipment Available now
sa21713 Essential Splice Site Available for shipment Available now
sa38792 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7336 Missense Mutation detected in F1 DNA During 2018
sa11365 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091115 Nonsense 34 1521 1 22
ENSDART00000138045 Nonsense 34 1361 2 21
Genomic Location (Zv9):
Chromosome 10 (position 20668418)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20629832
GRCz11 10 20587213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCCCCTCAGCTTATTGACTCCGCTAACATCAGACAGGAGGATGTCTA[T/A]GAAGCCATCAGTGACCCAGGAGATGATGGAGGACAGCAAAACTTTGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091115 Nonsense 46 1521 1 22
ENSDART00000138045 Nonsense 46 1361 2 21
Genomic Location (Zv9):
Chromosome 10 (position 20668384)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20629798
GRCz11 10 20587179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGGAGGAYGTCKATGAAGCCATCAGTGACCCAGGAGATGATGGAGGA[C/T]AGCAAAACTTTGATTCTCCTCTGGAGTCCGGCTTTTCATACCCMGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091115 Nonsense 71 1521 1 22
ENSDART00000138045 Nonsense 71 1361 2 21
Genomic Location (Zv9):
Chromosome 10 (position 20668307)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20629721
GRCz11 10 20587102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGGCTTTTCATACCCAGCTGAAGACGTCCCAGTCATTACAAATGGTTA[C/A]CCTACGGGTGTAGGTACCTATGAGCAACAGGCCAAGTTTGCCTTGTACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091115 Nonsense 289 1521 1 22
ENSDART00000138045 Nonsense 289 1361 2 21
Genomic Location (Zv9):
Chromosome 10 (position 20667655)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20629069
GRCz11 10 20586450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGAAAAAGAGAGGCAGCAGACATGGCGCTGGTCATGAAGAAAGCCAA[C/T]AGCCAAGCAAAGTTGAGGAGGAGCGGTCAGTTGTGGTGCACAACCCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091115 Nonsense 369 1521 2 22
ENSDART00000138045 Nonsense 369 1361 3 21
Genomic Location (Zv9):
Chromosome 10 (position 20667322)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20628736
GRCz11 10 20586117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGARATTGGTGACTTGGTGTGGGCAAAAGTTGGGACGTATCCTTGGTG[G/A]CCATGCATGGTGTCATCAGACCCACAGTCGAACGTTCATACACGTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091115 Essential Splice Site 857 1521 10 22
ENSDART00000138045 Essential Splice Site 857 1361 11 21
Genomic Location (Zv9):
Chromosome 10 (position 20658399)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20619813
GRCz11 10 20577194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCAACAGTGGAAAAGAGAGTGAAACTGTGTGTCAGGAGTGCAAGACAG[G/T]TGAACAATACGTCTGATTTGGGATCAGATTTTTAAAGGCTATTTTGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091115 Essential Splice Site 923 1521 11 22
ENSDART00000138045 Essential Splice Site 923 1361 12 21
Genomic Location (Zv9):
Chromosome 10 (position 20658034)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20619448
GRCz11 10 20576829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGTGCCACTTGCTGTCTCGACAGAGACCTTCAAAAAGCTGGCAAAG[G/A]TACACAACAGATATAAGAAATATTTGAAAAATTAGACTGATGAAATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091115 Missense 930 1521 12 22
ENSDART00000138045 Missense 930 1361 13 21
Genomic Location (Zv9):
Chromosome 10 (position 20656454)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20617868
GRCz11 10 20575249
KASP Assay ID:
554-4263.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RATGTYTAATGAGCTTTNATTTATTTCTTTAGGTCGTATGATGCGATGTA[T/A]CCGCTGTCCAGTGGCCTATCACACAGGAGACGGCTGTGTGGCAGCTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091115 Essential Splice Site 1044 1521 14 22
ENSDART00000138045 Essential Splice Site 1044 1361 15 21
Genomic Location (Zv9):
Chromosome 10 (position 20646386)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20607800
GRCz11 10 20565181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGCCCCACTATAAGCAGATAGTCTGGGTCAAGTTGGGCAACTACAGG[T/C]ACGTCTTTTATACTGTTGGAAGTCTCCTCCGATGCATTTAACTAAACTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link