zgc:158403

Ensembl ID:
ENSDARG00000062757
ZFIN ID:
ZDB-GENE-061215-116
Description:
Tetratricopeptide repeat protein 39A [Source:UniProtKB/Swiss-Prot;Acc:A1A5Y5]
Human Orthologue:
TTC39A
Human Description:
tetratricopeptide repeat domain 39A [Source:HGNC Symbol;Acc:18657]
Mouse Orthologue:
Ttc39a
Mouse Description:
tetratricopeptide repeat domain 39A Gene [Source:MGI Symbol;Acc:MGI:2444350]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16320 Nonsense Available for shipment Available now
sa40015 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091070 Nonsense 151 565 6 18

The following transcripts of ENSDARG00000062757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 14270870)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14516377
GRCz11 3 14666177
KASP Assay ID:
2259-3154.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAATATGGTGAGTTTTATTAAAGGAGGAATCAAAGTACGGAACAGTTA[C/A]CTCATATAYAAGTAAGTGAGTGACRGAAATCTGTRYYATCAAAACACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091070 Essential Splice Site 188 565 7 18

The following transcripts of ENSDARG00000062757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 14272472)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14517979
GRCz11 3 14667779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCACTTAGAGGGCGGAGTCTCGTTTGGCATCGGCGCTTTTAATTTGG[T/C]ATGTTCATCTGGAATGCTGCATCTGTTTTTATTCGCATAAATGTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091070 Nonsense 474 565 16 18

The following transcripts of ENSDARG00000062757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 14289044)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14534551
GRCz11 3 14684351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACGACACRTGTTTAATCCAGCTTCTGAAAGGCCTGTGTCTGAAGAAC[C/T]AAGGCCAGATGCAGGCGGCAGAGGACTGTTTCAACCAGGTTTACATCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link