naif1

Ensembl ID:
ENSDARG00000062753
ZFIN ID:
ZDB-GENE-081104-236
Description:
nuclear apoptosis-inducing factor 1 [Source:RefSeq peptide;Acc:NP_001119877]
Human Orthologue:
NAIF1
Human Description:
nuclear apoptosis inducing factor 1 [Source:HGNC Symbol;Acc:25446]
Mouse Orthologue:
Naif1
Mouse Description:
nuclear apoptosis inducing factor 1 Gene [Source:MGI Symbol;Acc:MGI:1918504]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45307 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091109   128 321 1 3
ENSDART00000143242 Essential Splice Site 128 303 None 3
Genomic Location (Zv9):
Chromosome 8 (position 2817835)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2584224
GRCz11 8 2642767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTGCTGGGCGAAGCGACCATCATCAGCCTCCCGGCGGCGGACGCGGG[T/A]ACGGAGATCGCGGTGCCTATCAGCTCCGCAGCCGCCGTCACTTTAACGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link