A5WZG4_DANRE

Ensembl ID:
ENSDARG00000062725
Description:
Unc5Da [Source:UniProtKB/TrEMBL;Acc:A5WZG4]
Human Orthologue:
UNC5CL
Human Description:
unc-5 homolog C (C. elegans)-like [Source:HGNC Symbol;Acc:21203]
Mouse Orthologue:
Unc5cl
Mouse Description:
unc-5 homolog C (C. elegans)-like Gene [Source:MGI Symbol;Acc:MGI:1923839]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43612 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090991 Nonsense 568 934 11 16
Genomic Location (Zv9):
Chromosome 21 (position 14589541)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 16212958
GRCz11 21 16308935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTTTATGCCCAGTGCTTTGTCTGATGAAGCTCAGGAGATACTGT[T/A]GAGTCCAGAGGTGACATACGGTCCTCCTGGCCTGAGTCTGTCCTGCCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Esophageal cancer: Genome-wide association study identifies three new susceptibility loci for esophageal squamous-cell carcinoma in Chinese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link